EMAIL THIS PAGE TO A FRIEND

CHMP3

charged multivesicular body protein 3

Synonyms: NEDF VPS24
Gene ID:
Human(51652) Summary: This gene encodes a protein that sorts transmembrane proteins into lysosomes/vacuoles via the multivesicular body (MVB) pathway. This protein, along with other soluble coiled-coil containing proteins, forms part of the ESCRT-III protein complex that binds to the endosomal membrane and recruits additional cofactors for protein sorting into the MVB. This protein may also co-immunoprecipitate with a member of the IFG-binding protein superfamily. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ring finger protein 103 (RNF103) gene. [provided by RefSeq, Nov 2010]
Mouse(66700) charged multivesicular body protein 3
Rat(282834) charged multivesicular body protein 3
Zebrafish(406621) charged multivesicular body protein 3
dog(475762) charged multivesicular body protein 3
domestic cat(101094500) charged multivesicular body protein 3
cow(507722) vacuolar protein sorting 24 homolog (S. cerevisiae)
chicken(422918) charged multivesicular body protein 3
domestic guinea pig(100727308) charged multivesicular body protein 3
sheep(101107266) charged multivesicular body protein 3
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301679 Anti-CHMP3 affinity isolated antibody human
immunohistochemistry pricing
HPA015673 Anti-CHMP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV34452 Anti-VPS24 antibody produced in rabbit affinity isolated antibody bovine, human, mouse, guinea pig, horse, rat, canine, zebrafish, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016079 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005753 Rosetta Predictions human pricing
NM_016079 Rosetta Predictions human pricing
NM_172331 Rosetta Predictions rat pricing
NM_025783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160242 predicted 980
2 SASI_Hs01_00160243 predicted 477
3 SASI_Hs01_00160244 predicted 1176
4 SASI_Hs01_00160245 predicted 813
5 SASI_Hs01_00160246 predicted 426
6 SASI_Hs01_00160247 predicted 563
7 SASI_Hs01_00160248 predicted 479
8 SASI_Hs01_00160249 predicted 932
9 SASI_Hs01_00160250 predicted 812
10 SASI_Hs01_00160251 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075632 predicted 1041
2 SASI_Hs01_00075633 predicted 539
3 SASI_Hs01_00075634 predicted 1236
4 SASI_Hs01_00075635 predicted 869
5 SASI_Hs01_00075636 predicted 490
6 SASI_Hs01_00075637 predicted 621
7 SASI_Hs01_00075638 predicted 536
8 SASI_Hs01_00075639 predicted 991
9 SASI_Hs01_00075640 predicted 865
10 SASI_Hs01_00075641 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034682 predicted 255
2 SASI_Rn01_00034683 predicted 546
3 SASI_Rn01_00034684 predicted 277
4 SASI_Rn01_00034685 predicted 551
5 SASI_Rn01_00034686 predicted 392
6 SASI_Rn01_00034687 predicted 215
7 SASI_Rn01_00034688 predicted 494
8 SASI_Rn01_00034689 predicted 433
9 SASI_Rn01_00034690 predicted 453
10 SASI_Rn01_00034691 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088196 predicted 216
2 SASI_Mm02_00329011 predicted 579
3 SASI_Mm02_00329012 predicted 854
4 SASI_Mm01_00088197 predicted 207
5 SASI_Mm01_00088198 predicted 222
6 SASI_Mm01_00088199 predicted 211
7 SASI_Mm01_00088200 predicted 472
8 SASI_Mm01_00088201 predicted 527
9 SASI_Mm01_00088202 predicted 462
10 SASI_Mm01_00088203 predicted 890
11 SASI_Mm01_00088204 predicted 232
12 SASI_Mm01_00088205 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025783
VALIDATED
CHMP3 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025783.3-1107s21c1
Sequence:GTACCGGGAATGATGAGGACTCTATATTCTCGAGAATATAGAGTCCTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025783.3-958s21c1
Sequence:GTACCGGCACGATCTGCAGAGGATTTAACTCGAGTTAAATCCTCTGCAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-369s21c1
Sequence:CCGGTGCCTCCAAAGCACACATGAACTCGAGTTCATGTGTGCTTTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-483s21c1
Sequence:CCGGTCTTGTGAAGATCCCAGAAATCTCGAGATTTCTGGGATCTTCACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-326s21c1
Sequence:CCGGCCAAGGAGATGATCAGGTCAACTCGAGTTGACCTGATCATCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-166s21c1
Sequence:CCGGCCTCCCAAAGAGCTGGTTAATCTCGAGATTAACCAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025783.2-2390s1c1
Sequence:CCGGCGCCTGGATTTCTTCGTTGTTCTCGAGAACAACGAAGAAATCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-327s1c1
Sequence:CCGGCCAAGGAGATGATCAGGTCAACTCGAGTTGACCTGATCATCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-370s1c1
Sequence:CCGGTGCCTCCAAAGCACACATGAACTCGAGTTCATGTGTGCTTTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-484s1c1
Sequence:CCGGTCTTGTGAAGATCCCAGAAATCTCGAGATTTCTGGGATCTTCACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-167s1c1
Sequence:CCGGCCTCCCAAAGAGCTGGTTAATCTCGAGATTAACCAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025783
VALIDATED
CHMP3 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025783.3-1107s21c1
Sequence:GTACCGGGAATGATGAGGACTCTATATTCTCGAGAATATAGAGTCCTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025783.3-958s21c1
Sequence:GTACCGGCACGATCTGCAGAGGATTTAACTCGAGTTAAATCCTCTGCAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-369s21c1
Sequence:CCGGTGCCTCCAAAGCACACATGAACTCGAGTTCATGTGTGCTTTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-483s21c1
Sequence:CCGGTCTTGTGAAGATCCCAGAAATCTCGAGATTTCTGGGATCTTCACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-326s21c1
Sequence:CCGGCCAAGGAGATGATCAGGTCAACTCGAGTTGACCTGATCATCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-166s21c1
Sequence:CCGGCCTCCCAAAGAGCTGGTTAATCTCGAGATTAACCAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025783.2-2390s1c1
Sequence:CCGGCGCCTGGATTTCTTCGTTGTTCTCGAGAACAACGAAGAAATCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-327s1c1
Sequence:CCGGCCAAGGAGATGATCAGGTCAACTCGAGTTGACCTGATCATCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-370s1c1
Sequence:CCGGTGCCTCCAAAGCACACATGAACTCGAGTTCATGTGTGCTTTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-484s1c1
Sequence:CCGGTCTTGTGAAGATCCCAGAAATCTCGAGATTTCTGGGATCTTCACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-167s1c1
Sequence:CCGGCCTCCCAAAGAGCTGGTTAATCTCGAGATTAACCAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025783
VALIDATED
CHMP3 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025783.3-1107s21c1
Sequence:GTACCGGGAATGATGAGGACTCTATATTCTCGAGAATATAGAGTCCTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025783.3-958s21c1
Sequence:GTACCGGCACGATCTGCAGAGGATTTAACTCGAGTTAAATCCTCTGCAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-369s21c1
Sequence:CCGGTGCCTCCAAAGCACACATGAACTCGAGTTCATGTGTGCTTTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-483s21c1
Sequence:CCGGTCTTGTGAAGATCCCAGAAATCTCGAGATTTCTGGGATCTTCACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-326s21c1
Sequence:CCGGCCAAGGAGATGATCAGGTCAACTCGAGTTGACCTGATCATCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025783.3-166s21c1
Sequence:CCGGCCTCCCAAAGAGCTGGTTAATCTCGAGATTAACCAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025783.2-2390s1c1
Sequence:CCGGCGCCTGGATTTCTTCGTTGTTCTCGAGAACAACGAAGAAATCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-327s1c1
Sequence:CCGGCCAAGGAGATGATCAGGTCAACTCGAGTTGACCTGATCATCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-370s1c1
Sequence:CCGGTGCCTCCAAAGCACACATGAACTCGAGTTCATGTGTGCTTTGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-484s1c1
Sequence:CCGGTCTTGTGAAGATCCCAGAAATCTCGAGATTTCTGGGATCTTCACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025783.2-167s1c1
Sequence:CCGGCCTCCCAAAGAGCTGGTTAATCTCGAGATTAACCAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016079
VALIDATED
CHMP3 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016079.2-530s21c1
Sequence:GTACCGGTGATGAAGGCTGGGATCATAGCTCGAGCTATGATCCCAGCCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-212s21c1
Sequence:GTACCGGGAGTTGTTGACAGGCAAATAACTCGAGTTATTTGCCTGTCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-177s21c1
Sequence:CCGGCAATGAGTGGTCATTGAAGATCTCGAGATCTTCAATGACCACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-259s21c1
Sequence:CCGGGTGAAACGATCTGTGAAAGATCTCGAGATCTTTCACAGATCGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-472s21c1
Sequence:CCGGCAAAGTCTTGTGAAGATTCCACTCGAGTGGAATCTTCACAAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-586s21c1
Sequence:CCGGGATCAGGAAGAAATGGAGGAACTCGAGTTCCTCCATTTCTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016079.2-1167s21c1
Sequence:GTACCGGTAGATTGCCCTGTGCAGTAAACTCGAGTTTACTGCACAGGGCAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016079.2-944s21c1
Sequence:GTACCGGTCGCAAAGGGATTGTTCTTATCTCGAGATAAGAACAATCCCTTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016079.1-556s1c1
Sequence:CCGGGCACCCAGTAAAGTGACTGATCTCGAGATCAGTCACTTTACTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016079.1-361s1c1
Sequence:CCGGCAAAGTCTTGTGAAGATTCCACTCGAGTGGAATCTTCACAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016079.1-148s1c1
Sequence:CCGGGTGAAACGATCTGTGAAAGATCTCGAGATCTTTCACAGATCGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016079.1-66s1c1
Sequence:CCGGCAATGAGTGGTCATTGAAGATCTCGAGATCTTCAATGACCACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016079.1-475s1c1
Sequence:CCGGGATCAGGAAGAAATGGAGGAACTCGAGTTCCTCCATTTCTTCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016079
VALIDATED
CHMP3 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016079.2-530s21c1
Sequence:GTACCGGTGATGAAGGCTGGGATCATAGCTCGAGCTATGATCCCAGCCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-212s21c1
Sequence:GTACCGGGAGTTGTTGACAGGCAAATAACTCGAGTTATTTGCCTGTCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-177s21c1
Sequence:CCGGCAATGAGTGGTCATTGAAGATCTCGAGATCTTCAATGACCACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-259s21c1
Sequence:CCGGGTGAAACGATCTGTGAAAGATCTCGAGATCTTTCACAGATCGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-472s21c1
Sequence:CCGGCAAAGTCTTGTGAAGATTCCACTCGAGTGGAATCTTCACAAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-586s21c1
Sequence:CCGGGATCAGGAAGAAATGGAGGAACTCGAGTTCCTCCATTTCTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016079.2-1167s21c1
Sequence:GTACCGGTAGATTGCCCTGTGCAGTAAACTCGAGTTTACTGCACAGGGCAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016079.2-944s21c1
Sequence:GTACCGGTCGCAAAGGGATTGTTCTTATCTCGAGATAAGAACAATCCCTTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016079.1-556s1c1
Sequence:CCGGGCACCCAGTAAAGTGACTGATCTCGAGATCAGTCACTTTACTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016079.1-361s1c1
Sequence:CCGGCAAAGTCTTGTGAAGATTCCACTCGAGTGGAATCTTCACAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016079.1-148s1c1
Sequence:CCGGGTGAAACGATCTGTGAAAGATCTCGAGATCTTTCACAGATCGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016079.1-66s1c1
Sequence:CCGGCAATGAGTGGTCATTGAAGATCTCGAGATCTTCAATGACCACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016079.1-475s1c1
Sequence:CCGGGATCAGGAAGAAATGGAGGAACTCGAGTTCCTCCATTTCTTCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016079
VALIDATED
CHMP3 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016079.2-530s21c1
Sequence:GTACCGGTGATGAAGGCTGGGATCATAGCTCGAGCTATGATCCCAGCCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-212s21c1
Sequence:GTACCGGGAGTTGTTGACAGGCAAATAACTCGAGTTATTTGCCTGTCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-177s21c1
Sequence:CCGGCAATGAGTGGTCATTGAAGATCTCGAGATCTTCAATGACCACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-259s21c1
Sequence:CCGGGTGAAACGATCTGTGAAAGATCTCGAGATCTTTCACAGATCGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-472s21c1
Sequence:CCGGCAAAGTCTTGTGAAGATTCCACTCGAGTGGAATCTTCACAAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016079.2-586s21c1
Sequence:CCGGGATCAGGAAGAAATGGAGGAACTCGAGTTCCTCCATTTCTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016079.2-1167s21c1
Sequence:GTACCGGTAGATTGCCCTGTGCAGTAAACTCGAGTTTACTGCACAGGGCAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016079.2-944s21c1
Sequence:GTACCGGTCGCAAAGGGATTGTTCTTATCTCGAGATAAGAACAATCCCTTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016079.1-556s1c1
Sequence:CCGGGCACCCAGTAAAGTGACTGATCTCGAGATCAGTCACTTTACTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016079.1-361s1c1
Sequence:CCGGCAAAGTCTTGTGAAGATTCCACTCGAGTGGAATCTTCACAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016079.1-148s1c1
Sequence:CCGGGTGAAACGATCTGTGAAAGATCTCGAGATCTTTCACAGATCGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016079.1-66s1c1
Sequence:CCGGCAATGAGTGGTCATTGAAGATCTCGAGATCTTCAATGACCACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016079.1-475s1c1
Sequence:CCGGGATCAGGAAGAAATGGAGGAACTCGAGTTCCTCCATTTCTTCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks