EMAIL THIS PAGE TO A FRIEND

CHMP4A

charged multivesicular body protein 4A

19 Gene Product Result for
Synonyms: C14orf123 CHMP4 CHMP4B HSPC134 SHAX2 SNF7 SNF7-1 VPS32-1 VPS32A
UniProtKB ID: Q9BY43, Q32Q79, Q86SZ8, Q96QJ9, Q9P026
Gene ID:
Human(29082) Summary: CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]
sheep(101119907) charged multivesicular body protein 4A
cow(613647) charged multivesicular body protein 4A
domestic cat(101080716) charged multivesicular body protein 4A
dog(480263) charged multivesicular body protein 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014169 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099851 MISSION® esiRNA esiRNA human CHMP4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014169 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039745 predicted 622
2 SASI_Hs01_00039747 predicted 897
3 SASI_Hs01_00039748 predicted 767
4 SASI_Hs01_00039749 predicted 923
5 SASI_Hs01_00039750 predicted 791
6 SASI_Hs01_00039751 predicted 1229
7 SASI_Hs01_00039752 predicted 762
8 SASI_Hs01_00039753 predicted 1045
9 SASI_Hs01_00039754 predicted 1086
10 SASI_Hs02_00345168 predicted 673
11 SASI_Hs01_00039746 predicted 1175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014169
VALIDATED
CHMP4A MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 4A
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014169.2-1275s1c1
Sequence:CCGGGAGCTAAAGGAGGATAACTTTCTCGAGAAAGTTATCCTCCTTTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014169.2-901s1c1
Sequence:CCGGGACATTGACAAGGTAGATGAACTCGAGTTCATCTACCTTGTCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-624s1c1
Sequence:CCGGGACAGAGAAGATACTGATCAACTCGAGTTGATCAGTATCTTCTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-770s1c1
Sequence:CCGGCACAAACTGACGGGACATTATCTCGAGATAATGTCCCGTCAGTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014169.2-1249s1c1
Sequence:CCGGCCTTTCTTCCTTAAGTGCCAACTCGAGTTGGCACTTAAGGAAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-693s1c1
Sequence:CCGGCAAGAAGTATGGGACCAAGAACTCGAGTTCTTGGTCCCATACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-887s21c1
Sequence:GTACCGGCCTACCAGGACATGGACATTGCTCGAGCAATGTCCATGTCCTGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-669s21c1
Sequence:GTACCGGGATTCAACAGGAGCTACAAACCTCGAGGTTTGTAGCTCCTGTTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-624s21c1
Sequence:CCGGGACAGAGAAGATACTGATCAACTCGAGTTGATCAGTATCTTCTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-1249s21c1
Sequence:CCGGCCTTTCTTCCTTAAGTGCCAACTCGAGTTGGCACTTAAGGAAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-770s21c1
Sequence:CCGGCACAAACTGACGGGACATTATCTCGAGATAATGTCCCGTCAGTTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-1275s21c1
Sequence:CCGGGAGCTAAAGGAGGATAACTTTCTCGAGAAAGTTATCCTCCTTTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-806s21c1
Sequence:GTACCGGAGCGTGAGGCCATTGAGAATGCTCGAGCATTCTCAATGGCCTCACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-960s21c1
Sequence:GTACCGGGCAGATCTCAGATGCCATTTCCTCGAGGAAATGGCATCTGAGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-1092s21c1
Sequence:GTACCGGAGAAGAACCCTCAGTCAAATTCTCGAGAATTTGACTGAGGGTTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014169
VALIDATED
CHMP4A MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 4A
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014169.2-1275s1c1
Sequence:CCGGGAGCTAAAGGAGGATAACTTTCTCGAGAAAGTTATCCTCCTTTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014169.2-901s1c1
Sequence:CCGGGACATTGACAAGGTAGATGAACTCGAGTTCATCTACCTTGTCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-624s1c1
Sequence:CCGGGACAGAGAAGATACTGATCAACTCGAGTTGATCAGTATCTTCTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-770s1c1
Sequence:CCGGCACAAACTGACGGGACATTATCTCGAGATAATGTCCCGTCAGTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014169.2-1249s1c1
Sequence:CCGGCCTTTCTTCCTTAAGTGCCAACTCGAGTTGGCACTTAAGGAAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-693s1c1
Sequence:CCGGCAAGAAGTATGGGACCAAGAACTCGAGTTCTTGGTCCCATACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-887s21c1
Sequence:GTACCGGCCTACCAGGACATGGACATTGCTCGAGCAATGTCCATGTCCTGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-669s21c1
Sequence:GTACCGGGATTCAACAGGAGCTACAAACCTCGAGGTTTGTAGCTCCTGTTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-624s21c1
Sequence:CCGGGACAGAGAAGATACTGATCAACTCGAGTTGATCAGTATCTTCTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-1249s21c1
Sequence:CCGGCCTTTCTTCCTTAAGTGCCAACTCGAGTTGGCACTTAAGGAAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-770s21c1
Sequence:CCGGCACAAACTGACGGGACATTATCTCGAGATAATGTCCCGTCAGTTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-1275s21c1
Sequence:CCGGGAGCTAAAGGAGGATAACTTTCTCGAGAAAGTTATCCTCCTTTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-806s21c1
Sequence:GTACCGGAGCGTGAGGCCATTGAGAATGCTCGAGCATTCTCAATGGCCTCACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-960s21c1
Sequence:GTACCGGGCAGATCTCAGATGCCATTTCCTCGAGGAAATGGCATCTGAGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-1092s21c1
Sequence:GTACCGGAGAAGAACCCTCAGTCAAATTCTCGAGAATTTGACTGAGGGTTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014169
VALIDATED
CHMP4A MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 4A
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014169.2-1275s1c1
Sequence:CCGGGAGCTAAAGGAGGATAACTTTCTCGAGAAAGTTATCCTCCTTTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014169.2-901s1c1
Sequence:CCGGGACATTGACAAGGTAGATGAACTCGAGTTCATCTACCTTGTCAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-624s1c1
Sequence:CCGGGACAGAGAAGATACTGATCAACTCGAGTTGATCAGTATCTTCTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-770s1c1
Sequence:CCGGCACAAACTGACGGGACATTATCTCGAGATAATGTCCCGTCAGTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014169.2-1249s1c1
Sequence:CCGGCCTTTCTTCCTTAAGTGCCAACTCGAGTTGGCACTTAAGGAAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014169.2-693s1c1
Sequence:CCGGCAAGAAGTATGGGACCAAGAACTCGAGTTCTTGGTCCCATACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-887s21c1
Sequence:GTACCGGCCTACCAGGACATGGACATTGCTCGAGCAATGTCCATGTCCTGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-669s21c1
Sequence:GTACCGGGATTCAACAGGAGCTACAAACCTCGAGGTTTGTAGCTCCTGTTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-624s21c1
Sequence:CCGGGACAGAGAAGATACTGATCAACTCGAGTTGATCAGTATCTTCTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-1249s21c1
Sequence:CCGGCCTTTCTTCCTTAAGTGCCAACTCGAGTTGGCACTTAAGGAAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-770s21c1
Sequence:CCGGCACAAACTGACGGGACATTATCTCGAGATAATGTCCCGTCAGTTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014169.2-1275s21c1
Sequence:CCGGGAGCTAAAGGAGGATAACTTTCTCGAGAAAGTTATCCTCCTTTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-806s21c1
Sequence:GTACCGGAGCGTGAGGCCATTGAGAATGCTCGAGCATTCTCAATGGCCTCACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-960s21c1
Sequence:GTACCGGGCAGATCTCAGATGCCATTTCCTCGAGGAAATGGCATCTGAGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014169.2-1092s21c1
Sequence:GTACCGGAGAAGAACCCTCAGTCAAATTCTCGAGAATTTGACTGAGGGTTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)