EMAIL THIS PAGE TO A FRIEND

CHMP4B

charged multivesicular body protein 4B

133 Gene Product Result for
Synonyms: C20orf178 CHMP4A CTPP3 CTRCT31 SNF7 SNF7-2 Shax1 VPS32B Vps32-2 dJ553F4.4
UniProtKB ID: Q9H444, E1P5N4, Q53ZD6
Gene ID:
Human(128866) Summary: This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein (CHMP) protein family. The protein is part of the endosomal sorting complex required for transport (ESCRT) complex III (ESCRT-III), which functions in the sorting of endocytosed cell-surface receptors into multivesicular endosomes. The ESCRT machinery also functions in the final abscisson stage of cytokinesis and in the budding of enveloped viruses such as HIV-1. The three proteins of the CHMP4 subfamily interact with programmed cell death 6 interacting protein (PDCD6IP, also known as ALIX), which also functions in the ESCRT pathway. The CHMP4 proteins assemble into membrane-attached 5-nm filaments that form circular scaffolds and promote or stabilize outward budding. These polymers are proposed to help generate the luminal vesicles of multivesicular bodies. Mutations in this gene result in autosomal dominant posterior polar cataracts.[provided by RefSeq, Oct 2009]
Mouse(75608) charged multivesicular body protein 4B
Rat(100359642) charged multivesicular body protein 4B
Zebrafish(406766) chromatin modifying protein 4B
cow(616164) charged multivesicular body protein 4B
domestic cat(101097964) charged multivesicular body protein 4B
chicken(419150) chromatin modifying protein 4B
dog(485842) charged multivesicular body protein 4B
sheep(101111216) charged multivesicular body protein 4B
domestic guinea pig(100714567) charged multivesicular body protein 4B
naked mole-rat(101716032) charged multivesicular body protein 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016331 MISSION® esiRNA esiRNA targeting human CHMP4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176812 Rosetta Predictions human pricing
NM_029362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129003 predicted 483
2 SASI_Hs01_00129005 predicted 564
3 SASI_Hs02_00369226 predicted 478
4 SASI_Hs01_00129001 predicted 690
5 SASI_Hs01_00129004 predicted 690
6 SASI_Hs02_00369227 predicted 499
7 SASI_Hs02_00369228 predicted 1297
8 SASI_Hs02_00369229 predicted 783
9 SASI_Hs02_00369230 predicted 311
10 SASI_Hs02_00369231 predicted 1167
11 SASI_Hs01_00128996 predicted 734
12 SASI_Hs01_00128997 predicted 711
13 SASI_Hs01_00128998 predicted 513
14 SASI_Hs01_00128999 predicted 396
15 SASI_Hs01_00129000 predicted 657
16 SASI_Hs01_00129002 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113001 predicted 706
2 SASI_Mm01_00113003 predicted 378
3 SASI_Mm01_00113004 predicted 453
4 SASI_Mm01_00113005 predicted 599
5 SASI_Mm02_00335227 predicted 1255
6 SASI_Mm01_00113008 predicted 696
7 SASI_Mm01_00113009 predicted 655
8 SASI_Mm02_00335228 predicted 484
9 SASI_Mm02_00335229 predicted 416
10 SASI_Mm02_00335230 predicted 567
11 SASI_Mm01_00113000 predicted 271
12 SASI_Mm01_00113002 predicted 268
13 SASI_Mm01_00113006 predicted 203
14 SASI_Mm01_00113007 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176812
VALIDATED
CHMP4B MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-708s21c1
Sequence:CCGGGGAAATCAGTGGACCCGAAACCTCGAGGTTTCGGGTCCACTGATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-375s21c1
Sequence:CCGGGCGTAAGAAGAGGTATGAGAACTCGAGTTCTCATACCTCTTCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176812.4-1097s21c1
Sequence:CCGGGTATTTGCAAATCCAACATTGCTCGAGCAATGTTGGATTTGCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-623s21c1
Sequence:CCGGTAGGGTTTGGAGAAGAGTTTGCTCGAGCAAACTCTTCTCCAAACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176812.4-938s21c1
Sequence:CCGGGTTCCATCGCTTTCGACTCTCCTCGAGGAGAGTCGAAAGCGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176812.3-1167s1c1
Sequence:CCGGGCAGTTGAAATGACCTGAAATCTCGAGATTTCAGGTCATTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-541s1c1
Sequence:CCGGGATGAGTTAATGCAGGACATTCTCGAGAATGTCCTGCATTAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-261s1c1
Sequence:CCGGGTTAAGCAAGAAACAGGAGTTCTCGAGAACTCCTGTTTCTTGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-405s1c1
Sequence:CCGGCGGCACATTATCAACCATCGACTCGAGTCGATGGTTGATAATGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176812
VALIDATED
CHMP4B MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-708s21c1
Sequence:CCGGGGAAATCAGTGGACCCGAAACCTCGAGGTTTCGGGTCCACTGATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-375s21c1
Sequence:CCGGGCGTAAGAAGAGGTATGAGAACTCGAGTTCTCATACCTCTTCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176812.4-1097s21c1
Sequence:CCGGGTATTTGCAAATCCAACATTGCTCGAGCAATGTTGGATTTGCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-623s21c1
Sequence:CCGGTAGGGTTTGGAGAAGAGTTTGCTCGAGCAAACTCTTCTCCAAACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176812.4-938s21c1
Sequence:CCGGGTTCCATCGCTTTCGACTCTCCTCGAGGAGAGTCGAAAGCGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176812.3-1167s1c1
Sequence:CCGGGCAGTTGAAATGACCTGAAATCTCGAGATTTCAGGTCATTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-541s1c1
Sequence:CCGGGATGAGTTAATGCAGGACATTCTCGAGAATGTCCTGCATTAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-261s1c1
Sequence:CCGGGTTAAGCAAGAAACAGGAGTTCTCGAGAACTCCTGTTTCTTGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-405s1c1
Sequence:CCGGCGGCACATTATCAACCATCGACTCGAGTCGATGGTTGATAATGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176812
VALIDATED
CHMP4B MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-708s21c1
Sequence:CCGGGGAAATCAGTGGACCCGAAACCTCGAGGTTTCGGGTCCACTGATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-375s21c1
Sequence:CCGGGCGTAAGAAGAGGTATGAGAACTCGAGTTCTCATACCTCTTCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176812.4-1097s21c1
Sequence:CCGGGTATTTGCAAATCCAACATTGCTCGAGCAATGTTGGATTTGCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176812.4-623s21c1
Sequence:CCGGTAGGGTTTGGAGAAGAGTTTGCTCGAGCAAACTCTTCTCCAAACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176812.4-938s21c1
Sequence:CCGGGTTCCATCGCTTTCGACTCTCCTCGAGGAGAGTCGAAAGCGATGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176812.3-1167s1c1
Sequence:CCGGGCAGTTGAAATGACCTGAAATCTCGAGATTTCAGGTCATTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-541s1c1
Sequence:CCGGGATGAGTTAATGCAGGACATTCTCGAGAATGTCCTGCATTAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-261s1c1
Sequence:CCGGGTTAAGCAAGAAACAGGAGTTCTCGAGAACTCCTGTTTCTTGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_176812.3-405s1c1
Sequence:CCGGCGGCACATTATCAACCATCGACTCGAGTCGATGGTTGATAATGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029362
VALIDATED
CHMP4B MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 4B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029362.2-1383s1c1
Sequence:CCGGGCGAATAAGATTGTTAGAGTTCTCGAGAACTCTAACAATCTTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029362.2-738s1c1
Sequence:CCGGAGATGACGACATGAAGGAATTCTCGAGAATTCCTTCATGTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029362.2-201s1c1
Sequence:CCGGCACGGAGGAGATGTTAAGCAACTCGAGTTGCTTAACATCTCCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029362.2-306s1c1
Sequence:CCGGGCAGGCTCTGAAGCGCAAGAACTCGAGTTCTTGCGCTTCAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029362.2-466s1c1
Sequence:CCGGCACGACAACATGGACATTGATCTCGAGATCAATGTCCATGTTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029362
VALIDATED
CHMP4B MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 4B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029362.2-1383s1c1
Sequence:CCGGGCGAATAAGATTGTTAGAGTTCTCGAGAACTCTAACAATCTTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029362.2-738s1c1
Sequence:CCGGAGATGACGACATGAAGGAATTCTCGAGAATTCCTTCATGTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029362.2-201s1c1
Sequence:CCGGCACGGAGGAGATGTTAAGCAACTCGAGTTGCTTAACATCTCCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029362.2-306s1c1
Sequence:CCGGGCAGGCTCTGAAGCGCAAGAACTCGAGTTCTTGCGCTTCAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029362.2-466s1c1
Sequence:CCGGCACGACAACATGGACATTGATCTCGAGATCAATGTCCATGTTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029362
VALIDATED
CHMP4B MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 4B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029362.2-1383s1c1
Sequence:CCGGGCGAATAAGATTGTTAGAGTTCTCGAGAACTCTAACAATCTTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029362.2-738s1c1
Sequence:CCGGAGATGACGACATGAAGGAATTCTCGAGAATTCCTTCATGTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029362.2-201s1c1
Sequence:CCGGCACGGAGGAGATGTTAAGCAACTCGAGTTGCTTAACATCTCCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029362.2-306s1c1
Sequence:CCGGGCAGGCTCTGAAGCGCAAGAACTCGAGTTCTTGCGCTTCAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029362.2-466s1c1
Sequence:CCGGCACGACAACATGGACATTGATCTCGAGATCAATGTCCATGTTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks