EMAIL THIS PAGE TO A FRIEND

CHMP4C

charged multivesicular body protein 4C

87 Gene Product Result for
Synonyms: SNF7-3 Shax3 VPS32C
UniProtKB ID: Q96CF2, B2RBZ1
Gene ID:
Human(92421) Summary: CHMP4C belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]
Mouse(66371) charged multivesicular body protein 4C
Rat(361916) charged multivesicular body protein 4C
Zebrafish(550542) chromatin modifying protein 4C
chicken(420201) chromatin modifying protein 4C
dog(477926) charged multivesicular body protein 4C
cow(507572) charged multivesicular body protein 4C
domestic cat(101089076) charged multivesicular body protein 4C
domestic guinea pig(100723062) charged multivesicular body protein 4C
naked mole-rat(101704056) charged multivesicular body protein 4C
sheep(101119649) charged multivesicular body protein 4C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152284 Rosetta Predictions human pricing
NM_001017466 Rosetta Predictions rat pricing
NM_025519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125814 predicted 413
2 SASI_Hs02_00365830 predicted 346
3 SASI_Hs01_00125815 predicted 365
4 SASI_Hs01_00125816 predicted 394
5 SASI_Hs01_00125817 predicted 421
6 SASI_Hs01_00125818 predicted 711
7 SASI_Hs02_00365831 predicted 280
8 SASI_Hs01_00125820 predicted 513
9 SASI_Hs01_00125821 predicted 572
10 SASI_Hs01_00125822 predicted 704
11 SASI_Hs01_00125819 predicted 605
12 SASI_Hs01_00125823 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042399 predicted 403
2 SASI_Rn01_00042401 predicted 360
3 SASI_Rn01_00042402 predicted 402
4 SASI_Rn01_00042403 predicted 1294
5 SASI_Rn01_00042404 predicted 1295
6 SASI_Rn01_00042405 predicted 343
7 SASI_Rn01_00042406 predicted 224
8 SASI_Rn01_00042407 predicted 571
9 SASI_Rn01_00042408 predicted 522
10 SASI_Rn02_00202267 predicted 578
11 SASI_Rn01_00042400 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177735 predicted 734
2 SASI_Mm01_00177736 predicted 351
3 SASI_Mm01_00177737 predicted 787
4 SASI_Mm01_00177738 predicted 445
5 SASI_Mm01_00177739 predicted 414
6 SASI_Mm01_00177740 predicted 336
7 SASI_Mm01_00177741 predicted 303
8 SASI_Mm01_00177743 predicted 471
9 SASI_Mm02_00328419 predicted 355
10 SASI_Mm02_00328420 predicted 591
11 SASI_Mm01_00177734 predicted 486
12 SASI_Mm01_00177742 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152284
VALIDATED
CHMP4C MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 4C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152284.2-355s1c1
Sequence:CCGGGCAGAATAAGCGAGCTGCATTCTCGAGAATGCAGCTCGCTTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152284.2-425s1c1
Sequence:CCGGGATGGCACACTTTCTACCATTCTCGAGAATGGTAGAAAGTGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-718s1c1
Sequence:CCGGGACAAATATCCGCCTTCCAAACTCGAGTTTGGAAGGCGGATATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-521s1c1
Sequence:CCGGGCGATGAAATCTGTTCATGAACTCGAGTTCATGAACAGATTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-604s1c1
Sequence:CCGGCCAAGAAATCTCAGAAGCATTCTCGAGAATGCTTCTGAGATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-517s21c1
Sequence:CCGGGCGATGAAATCTGTTCATGAACTCGAGTTCATGAACAGATTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-714s21c1
Sequence:CCGGGACAAATATCCGCCTTCCAAACTCGAGTTTGGAAGGCGGATATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-600s21c1
Sequence:CCGGCCAAGAAATCTCAGAAGCATTCTCGAGAATGCTTCTGAGATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-351s21c1
Sequence:CCGGGCAGAATAAGCGAGCTGCATTCTCGAGAATGCAGCTCGCTTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152284
VALIDATED
CHMP4C MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 4C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152284.2-355s1c1
Sequence:CCGGGCAGAATAAGCGAGCTGCATTCTCGAGAATGCAGCTCGCTTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152284.2-425s1c1
Sequence:CCGGGATGGCACACTTTCTACCATTCTCGAGAATGGTAGAAAGTGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-718s1c1
Sequence:CCGGGACAAATATCCGCCTTCCAAACTCGAGTTTGGAAGGCGGATATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-521s1c1
Sequence:CCGGGCGATGAAATCTGTTCATGAACTCGAGTTCATGAACAGATTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-604s1c1
Sequence:CCGGCCAAGAAATCTCAGAAGCATTCTCGAGAATGCTTCTGAGATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-517s21c1
Sequence:CCGGGCGATGAAATCTGTTCATGAACTCGAGTTCATGAACAGATTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-714s21c1
Sequence:CCGGGACAAATATCCGCCTTCCAAACTCGAGTTTGGAAGGCGGATATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-600s21c1
Sequence:CCGGCCAAGAAATCTCAGAAGCATTCTCGAGAATGCTTCTGAGATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-351s21c1
Sequence:CCGGGCAGAATAAGCGAGCTGCATTCTCGAGAATGCAGCTCGCTTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152284
VALIDATED
CHMP4C MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 4C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152284.2-355s1c1
Sequence:CCGGGCAGAATAAGCGAGCTGCATTCTCGAGAATGCAGCTCGCTTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152284.2-425s1c1
Sequence:CCGGGATGGCACACTTTCTACCATTCTCGAGAATGGTAGAAAGTGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-718s1c1
Sequence:CCGGGACAAATATCCGCCTTCCAAACTCGAGTTTGGAAGGCGGATATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-521s1c1
Sequence:CCGGGCGATGAAATCTGTTCATGAACTCGAGTTCATGAACAGATTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152284.2-604s1c1
Sequence:CCGGCCAAGAAATCTCAGAAGCATTCTCGAGAATGCTTCTGAGATTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-517s21c1
Sequence:CCGGGCGATGAAATCTGTTCATGAACTCGAGTTCATGAACAGATTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-714s21c1
Sequence:CCGGGACAAATATCCGCCTTCCAAACTCGAGTTTGGAAGGCGGATATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-600s21c1
Sequence:CCGGCCAAGAAATCTCAGAAGCATTCTCGAGAATGCTTCTGAGATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152284.3-351s21c1
Sequence:CCGGGCAGAATAAGCGAGCTGCATTCTCGAGAATGCAGCTCGCTTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025519
VALIDATED
CHMP4C MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 4C
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-344s1c1
Sequence:CCGGGCTGGAGAACTCGCACACCAACTCGAGTTGGTGTGCGAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-443s1c1
Sequence:CCGGTGATGACTTGATGCAAGATATCTCGAGATATCTTGCATCAAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-575s1c1
Sequence:CCGGGCAGGAGGAATTAAATAAGAACTCGAGTTCTTATTTAATTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-1315s1c1
Sequence:CCGGCCGAAATACCTGAAAGCAGTACTCGAGTACTGCTTTCAGGTATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-510s1c1
Sequence:CCGGCAAAGGGTTCAGTTTGCCGATCTCGAGATCGGCAAACTGAACCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-600s21c1
Sequence:CCGGACAAGCCTGGAGCTTCCAAATCTCGAGATTTGGAAGCTCCAGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025519.2-1184s21c1
Sequence:CCGGACTTGTTCTAGTGAGTCTATGCTCGAGCATAGACTCACTAGAACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-180s21c1
Sequence:CCGGGAGTACCTGGAGAACCGAATCCTCGAGGATTCGGTTCTCCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-444s21c1
Sequence:CCGGGATGACTTGATGCAAGATATCCTCGAGGATATCTTGCATCAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-358s21c1
Sequence:CCGGACACCAACACGGAGGTCTTACCTCGAGGTAAGACCTCCGTGTTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025519.2-1063s21c1
Sequence:CCGGATACACCATCCCGAGGAATACCTCGAGGTATTCCTCGGGATGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-473s21c1
Sequence:CCGGGCAGGACATTGCCCAGGAAATCTCGAGATTTCCTGGGCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025519
VALIDATED
CHMP4C MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 4C
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-344s1c1
Sequence:CCGGGCTGGAGAACTCGCACACCAACTCGAGTTGGTGTGCGAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-443s1c1
Sequence:CCGGTGATGACTTGATGCAAGATATCTCGAGATATCTTGCATCAAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-575s1c1
Sequence:CCGGGCAGGAGGAATTAAATAAGAACTCGAGTTCTTATTTAATTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-1315s1c1
Sequence:CCGGCCGAAATACCTGAAAGCAGTACTCGAGTACTGCTTTCAGGTATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-510s1c1
Sequence:CCGGCAAAGGGTTCAGTTTGCCGATCTCGAGATCGGCAAACTGAACCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-600s21c1
Sequence:CCGGACAAGCCTGGAGCTTCCAAATCTCGAGATTTGGAAGCTCCAGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025519.2-1184s21c1
Sequence:CCGGACTTGTTCTAGTGAGTCTATGCTCGAGCATAGACTCACTAGAACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-180s21c1
Sequence:CCGGGAGTACCTGGAGAACCGAATCCTCGAGGATTCGGTTCTCCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-444s21c1
Sequence:CCGGGATGACTTGATGCAAGATATCCTCGAGGATATCTTGCATCAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-358s21c1
Sequence:CCGGACACCAACACGGAGGTCTTACCTCGAGGTAAGACCTCCGTGTTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025519.2-1063s21c1
Sequence:CCGGATACACCATCCCGAGGAATACCTCGAGGTATTCCTCGGGATGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-473s21c1
Sequence:CCGGGCAGGACATTGCCCAGGAAATCTCGAGATTTCCTGGGCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025519
VALIDATED
CHMP4C MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 4C
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-344s1c1
Sequence:CCGGGCTGGAGAACTCGCACACCAACTCGAGTTGGTGTGCGAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-443s1c1
Sequence:CCGGTGATGACTTGATGCAAGATATCTCGAGATATCTTGCATCAAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-575s1c1
Sequence:CCGGGCAGGAGGAATTAAATAAGAACTCGAGTTCTTATTTAATTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-1315s1c1
Sequence:CCGGCCGAAATACCTGAAAGCAGTACTCGAGTACTGCTTTCAGGTATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025519.1-510s1c1
Sequence:CCGGCAAAGGGTTCAGTTTGCCGATCTCGAGATCGGCAAACTGAACCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-600s21c1
Sequence:CCGGACAAGCCTGGAGCTTCCAAATCTCGAGATTTGGAAGCTCCAGGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025519.2-1184s21c1
Sequence:CCGGACTTGTTCTAGTGAGTCTATGCTCGAGCATAGACTCACTAGAACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-180s21c1
Sequence:CCGGGAGTACCTGGAGAACCGAATCCTCGAGGATTCGGTTCTCCAGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-444s21c1
Sequence:CCGGGATGACTTGATGCAAGATATCCTCGAGGATATCTTGCATCAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-358s21c1
Sequence:CCGGACACCAACACGGAGGTCTTACCTCGAGGTAAGACCTCCGTGTTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025519.2-1063s21c1
Sequence:CCGGATACACCATCCCGAGGAATACCTCGAGGTATTCCTCGGGATGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025519.2-473s21c1
Sequence:CCGGGCAGGACATTGCCCAGGAAATCTCGAGATTTCCTGGGCAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks