EMAIL THIS PAGE TO A FRIEND

CHMP5

charged multivesicular body protein 5

Synonyms: C9orf83 HSPC177 PNAS-2 SNF7DC2 Vps60
Gene ID:
Human(51510) Summary: CHMP5 belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]
Mouse(76959) charged multivesicular body protein 5
Rat(297995) charged multivesicular body protein 5
sheep(101104370) charged multivesicular body protein 5
naked mole-rat(101723765) charged multivesicular body protein 5
domestic guinea pig(100723271) charged multivesicular body protein 5
chicken(420968) charged multivesicular body protein 5
cow(539781) charged multivesicular body protein 5
domestic cat(101098995) charged multivesicular body protein 5
dog(474741) charged multivesicular body protein 5
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015961 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110841 MISSION® esiRNA esiRNA human CHMP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016410 Rosetta Predictions human pricing
NM_001025410 Rosetta Predictions rat pricing
NM_029814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218009 predicted 445
2 SASI_Hs01_00218010 predicted 789
3 SASI_Hs01_00218011 predicted 393
4 SASI_Hs01_00218012 predicted 262
5 SASI_Hs01_00218013 predicted 308
6 SASI_Hs01_00218014 predicted 455
7 SASI_Hs01_00218015 predicted 690
8 SASI_Hs01_00218016 predicted 697
9 SASI_Hs01_00218017 predicted 240
10 SASI_Hs01_00218018 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052988 predicted 275
2 SASI_Rn01_00052989 predicted 329
3 SASI_Rn01_00052990 predicted 449
4 SASI_Rn01_00052991 predicted 202
5 SASI_Rn01_00052992 predicted 360
6 SASI_Rn01_00052993 predicted 288
7 SASI_Rn01_00052994 predicted 355
8 SASI_Rn01_00052995 predicted 203
9 SASI_Rn01_00052996 predicted 445
10 SASI_Rn01_00052997 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119248 predicted 302
2 SASI_Mm01_00119249 predicted 1123
3 SASI_Mm02_00335984 predicted 221
4 SASI_Mm02_00335985 predicted 376
5 SASI_Mm01_00119252 predicted 636
6 SASI_Mm02_00335986 predicted 370
7 SASI_Mm01_00119253 predicted 455
8 SASI_Mm02_00335987 predicted 425
9 SASI_Mm01_00119254 predicted 575
10 SASI_Mm02_00335988 predicted 232
11 SASI_Mm01_00119247 predicted 606
12 SASI_Mm01_00119250 predicted 617
13 SASI_Mm01_00119251 predicted 1134
14 SASI_Mm01_00119255 predicted 1134
15 SASI_Mm01_00119256 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029814
VALIDATED
CHMP5 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029814.1-1061s21c1
Sequence:CCGGGCTGATACATTGATAAGATAACTCGAGTTATCTTATCAATGTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-130s21c1
Sequence:CCGGTAGCAGGGCAGAATCCATTGACTCGAGTCAATGGATTCTGCCCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-429s21c1
Sequence:CCGGTTGACCAGATTGAGGACTTACCTCGAGGTAAGTCCTCAATCTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-708s21c1
Sequence:CCGGCTTCGTAGACTTACAACATTCCTCGAGGAATGTTGTAAGTCTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-316s21c1
Sequence:CCGGTAACATGGAGCAAGCTAATTACTCGAGTAATTAGCTTGCTCCATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-221s21c1
Sequence:CCGGCCTGCTAAGAACATGGTCAAACTCGAGTTTGACCATGTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029814.1-790s21c1
Sequence:CCGGCCAACCAGATTTAGGTTTCTTCTCGAGAAGAAACCTAAATCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-356s21c1
Sequence:CCGGGACACCAAGACCACGGTTGATCTCGAGATCAACCGTGGTCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-790s1c1
Sequence:CCGGCCAACCAGATTTAGGTTTCTTCTCGAGAAGAAACCTAAATCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-458s1c1
Sequence:CCGGCTGGAGGATATGATGGAAGATCTCGAGATCTTCCATCATATCCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029814.1-406s1c1
Sequence:CCGGGAAGGCATATAAGGAAGTAAACTCGAGTTTACTTCCTTATATGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029814.1-343s1c1
Sequence:CCGGCCAGTCACTAAAGGACACCAACTCGAGTTGGTGTCCTTTAGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-221s1c1
Sequence:CCGGCCTGCTAAGAACATGGTCAAACTCGAGTTTGACCATGTTCTTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029814
VALIDATED
CHMP5 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029814.1-1061s21c1
Sequence:CCGGGCTGATACATTGATAAGATAACTCGAGTTATCTTATCAATGTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-130s21c1
Sequence:CCGGTAGCAGGGCAGAATCCATTGACTCGAGTCAATGGATTCTGCCCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-429s21c1
Sequence:CCGGTTGACCAGATTGAGGACTTACCTCGAGGTAAGTCCTCAATCTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-708s21c1
Sequence:CCGGCTTCGTAGACTTACAACATTCCTCGAGGAATGTTGTAAGTCTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-316s21c1
Sequence:CCGGTAACATGGAGCAAGCTAATTACTCGAGTAATTAGCTTGCTCCATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-221s21c1
Sequence:CCGGCCTGCTAAGAACATGGTCAAACTCGAGTTTGACCATGTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029814.1-790s21c1
Sequence:CCGGCCAACCAGATTTAGGTTTCTTCTCGAGAAGAAACCTAAATCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-356s21c1
Sequence:CCGGGACACCAAGACCACGGTTGATCTCGAGATCAACCGTGGTCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-790s1c1
Sequence:CCGGCCAACCAGATTTAGGTTTCTTCTCGAGAAGAAACCTAAATCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-458s1c1
Sequence:CCGGCTGGAGGATATGATGGAAGATCTCGAGATCTTCCATCATATCCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029814.1-406s1c1
Sequence:CCGGGAAGGCATATAAGGAAGTAAACTCGAGTTTACTTCCTTATATGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029814.1-343s1c1
Sequence:CCGGCCAGTCACTAAAGGACACCAACTCGAGTTGGTGTCCTTTAGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-221s1c1
Sequence:CCGGCCTGCTAAGAACATGGTCAAACTCGAGTTTGACCATGTTCTTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029814
VALIDATED
CHMP5 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029814.1-1061s21c1
Sequence:CCGGGCTGATACATTGATAAGATAACTCGAGTTATCTTATCAATGTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-130s21c1
Sequence:CCGGTAGCAGGGCAGAATCCATTGACTCGAGTCAATGGATTCTGCCCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-429s21c1
Sequence:CCGGTTGACCAGATTGAGGACTTACCTCGAGGTAAGTCCTCAATCTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-708s21c1
Sequence:CCGGCTTCGTAGACTTACAACATTCCTCGAGGAATGTTGTAAGTCTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-316s21c1
Sequence:CCGGTAACATGGAGCAAGCTAATTACTCGAGTAATTAGCTTGCTCCATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-221s21c1
Sequence:CCGGCCTGCTAAGAACATGGTCAAACTCGAGTTTGACCATGTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029814.1-790s21c1
Sequence:CCGGCCAACCAGATTTAGGTTTCTTCTCGAGAAGAAACCTAAATCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029814.1-356s21c1
Sequence:CCGGGACACCAAGACCACGGTTGATCTCGAGATCAACCGTGGTCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-790s1c1
Sequence:CCGGCCAACCAGATTTAGGTTTCTTCTCGAGAAGAAACCTAAATCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-458s1c1
Sequence:CCGGCTGGAGGATATGATGGAAGATCTCGAGATCTTCCATCATATCCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029814.1-406s1c1
Sequence:CCGGGAAGGCATATAAGGAAGTAAACTCGAGTTTACTTCCTTATATGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029814.1-343s1c1
Sequence:CCGGCCAGTCACTAAAGGACACCAACTCGAGTTGGTGTCCTTTAGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029814.1-221s1c1
Sequence:CCGGCCTGCTAAGAACATGGTCAAACTCGAGTTTGACCATGTTCTTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015961
VALIDATED
CHMP5 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-392s1c1
Sequence:CCGGCCAGTGAAGATCGACCAGATTCTCGAGAATCTGGTCGATCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-116s1c1
Sequence:CCGGGAATCCATTGACAAGAAGATTCTCGAGAATCTTCTTGTCAATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-500s1c1
Sequence:CCGGCTGGATGAAGATGATTTAGAACTCGAGTTCTAAATCATCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-291s1c1
Sequence:CCGGCAACATGGACAGGCCATTATACTCGAGTATAATGGCCTGTCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-413s1c1
Sequence:CCGGGAGGATTTACAAGACCAGCTACTCGAGTAGCTGGTCTTGTAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-347s1c1
Sequence:CCGGGATGCTATGAAACTGGGAGTACTCGAGTACTCCCAGTTTCATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-269s1c1
Sequence:CCGGGACAATCTTGCCAACAGTCATCTCGAGATGACTGTTGGCAAGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-524s1c1
Sequence:CCGGGAGTTGGATGCACTAGGTGATCTCGAGATCACCTAGTGCATCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-379s1c1
Sequence:CCGGGAAGGCATACAAGCCAGTGAACTCGAGTTCACTGGCTTGTATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015961
VALIDATED
CHMP5 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-392s1c1
Sequence:CCGGCCAGTGAAGATCGACCAGATTCTCGAGAATCTGGTCGATCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-116s1c1
Sequence:CCGGGAATCCATTGACAAGAAGATTCTCGAGAATCTTCTTGTCAATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-500s1c1
Sequence:CCGGCTGGATGAAGATGATTTAGAACTCGAGTTCTAAATCATCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-291s1c1
Sequence:CCGGCAACATGGACAGGCCATTATACTCGAGTATAATGGCCTGTCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-413s1c1
Sequence:CCGGGAGGATTTACAAGACCAGCTACTCGAGTAGCTGGTCTTGTAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-347s1c1
Sequence:CCGGGATGCTATGAAACTGGGAGTACTCGAGTACTCCCAGTTTCATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-269s1c1
Sequence:CCGGGACAATCTTGCCAACAGTCATCTCGAGATGACTGTTGGCAAGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-524s1c1
Sequence:CCGGGAGTTGGATGCACTAGGTGATCTCGAGATCACCTAGTGCATCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-379s1c1
Sequence:CCGGGAAGGCATACAAGCCAGTGAACTCGAGTTCACTGGCTTGTATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015961
VALIDATED
CHMP5 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-392s1c1
Sequence:CCGGCCAGTGAAGATCGACCAGATTCTCGAGAATCTGGTCGATCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-116s1c1
Sequence:CCGGGAATCCATTGACAAGAAGATTCTCGAGAATCTTCTTGTCAATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-500s1c1
Sequence:CCGGCTGGATGAAGATGATTTAGAACTCGAGTTCTAAATCATCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-291s1c1
Sequence:CCGGCAACATGGACAGGCCATTATACTCGAGTATAATGGCCTGTCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-413s1c1
Sequence:CCGGGAGGATTTACAAGACCAGCTACTCGAGTAGCTGGTCTTGTAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-347s1c1
Sequence:CCGGGATGCTATGAAACTGGGAGTACTCGAGTACTCCCAGTTTCATAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-269s1c1
Sequence:CCGGGACAATCTTGCCAACAGTCATCTCGAGATGACTGTTGGCAAGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015961.1-524s1c1
Sequence:CCGGGAGTTGGATGCACTAGGTGATCTCGAGATCACCTAGTGCATCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015961.1-379s1c1
Sequence:CCGGGAAGGCATACAAGCCAGTGAACTCGAGTTCACTGGCTTGTATGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks