EMAIL THIS PAGE TO A FRIEND

CHMP6

charged multivesicular body protein 6

85 Gene Product Result for
Synonyms: VPS20
UniProtKB ID: Q96FZ7, A8K7U0, Q53FU4, Q9HAE8
Gene ID:
Human(79643) Summary: This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein family. Proteins in this family are part of the ESCRT-III (endosomal sorting complex required for transport III) which degrades surface receptors, and in biosynthesis of endosomes. [provided by RefSeq, Mar 2012]
Mouse(208092) charged multivesicular body protein 6
Rat(287873) charged multivesicular body protein 6
chicken(428673) charged multivesicular body protein 6
dog(608361) charged multivesicular body protein 6
cow(510596) charged multivesicular body protein 6
domestic cat(101087115) charged multivesicular body protein 6
domestic guinea pig(100730158) charged multivesicular body protein 6
naked mole-rat(101725742) charged multivesicular body protein 6
sheep(101110159) charged multivesicular body protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024591 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144401 MISSION® esiRNA esiRNA human CHMP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024591 Rosetta Predictions human pricing
NM_001105856 Rosetta Predictions rat pricing
NM_001085498 Rosetta Predictions mouse pricing
XM_126613 Rosetta Predictions mouse pricing
XM_903142 Rosetta Predictions mouse pricing
XM_903143 Rosetta Predictions mouse pricing
XM_903144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193792 predicted 502
2 SASI_Hs01_00193793 predicted 296
3 SASI_Hs01_00193794 predicted 833
4 SASI_Hs01_00193795 predicted 801
5 SASI_Hs01_00193796 predicted 275
6 SASI_Hs01_00193797 predicted 415
7 SASI_Hs01_00193798 predicted 797
8 SASI_Hs01_00193799 predicted 302
9 SASI_Hs02_00356926 predicted 514
10 SASI_Hs01_00193801 predicted 419
11 SASI_Hs01_00193800 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213202 predicted 1131
2 SASI_Rn02_00213203 predicted 949
3 SASI_Rn02_00213204 predicted 254
4 SASI_Rn02_00213205 predicted 533
5 SASI_Rn02_00213206 predicted 827
6 SASI_Rn02_00213207 predicted 315
7 SASI_Rn02_00213208 predicted 317
8 SASI_Rn02_00213209 predicted 1123
9 SASI_Rn02_00213210 predicted 500
10 SASI_Rn02_00213211 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300562 predicted 559
2 SASI_Mm02_00300563 predicted 1113
3 SASI_Mm02_00300564 predicted 669
4 SASI_Mm02_00300565 predicted 813
5 SASI_Mm02_00300566 predicted 1129
6 SASI_Mm02_00300567 predicted 945
7 SASI_Mm02_00300568 predicted 466
8 SASI_Mm02_00300569 predicted 847
9 SASI_Mm02_00300570 predicted 1137
10 SASI_Mm02_00300571 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280330 predicted 558
2 SASI_Mm01_00280331 predicted 1115
3 SASI_Mm01_00280332 predicted 669
4 SASI_Mm01_00280333 predicted 819
5 SASI_Mm01_00280334 predicted 1137
6 SASI_Mm01_00280335 predicted 947
7 SASI_Mm01_00280336 predicted 473
8 SASI_Mm01_00280337 predicted 853
9 SASI_Mm01_00280338 predicted 1145
10 SASI_Mm01_00280339 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281250 predicted 774
2 SASI_Mm01_00281251 predicted 1341
3 SASI_Mm01_00281252 predicted 888
4 SASI_Mm01_00281253 predicted 1033
5 SASI_Mm01_00281254 predicted 1355
6 SASI_Mm01_00281255 predicted 1168
7 SASI_Mm01_00281256 predicted 685
8 SASI_Mm01_00281257 predicted 1071
9 SASI_Mm01_00281258 predicted 1361
10 SASI_Mm01_00281259 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206180 predicted 440
2 SASI_Mm01_00206181 predicted 996
3 SASI_Mm01_00206182 predicted 546
4 SASI_Mm01_00206183 predicted 700
5 SASI_Mm01_00206184 predicted 1009
6 SASI_Mm01_00206185 predicted 824
7 SASI_Mm01_00206186 predicted 342
8 SASI_Mm01_00206187 predicted 728
9 SASI_Mm01_00206188 predicted 1016
10 SASI_Mm01_00206189 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254335 predicted 539
2 SASI_Mm01_00254336 predicted 1103
3 SASI_Mm01_00254337 predicted 659
4 SASI_Mm01_00254338 predicted 805
5 SASI_Mm01_00254339 predicted 1118
6 SASI_Mm01_00254340 predicted 933
7 SASI_Mm01_00254341 predicted 458
8 SASI_Mm01_00254342 predicted 829
9 SASI_Mm01_00254343 predicted 1122
10 SASI_Mm01_00254344 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024591
VALIDATED
CHMP6 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 6
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-526s1c1
Sequence:CCGGCAGGAACAAATAGAGCTGCCACTCGAGTGGCAGCTCTATTTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-515s1c1
Sequence:CCGGGCGCAATCACTCAGGAACAAACTCGAGTTTGTTCCTGAGTGATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024591.2-222s1c1
Sequence:CCGGGCTCAAGAAGAAGCGATACCACTCGAGTGGTATCGCTTCTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-345s1c1
Sequence:CCGGGCAGTTTGGAAATGAGTGTCTCTCGAGAGACACTCATTTCCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-318s1c1
Sequence:CCGGGATCGAAATGAAAGTGATGGACTCGAGTCCATCACTTTCATTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-517s1c1
Sequence:CCGGGCAATCACTCAGGAACAAATACTCGAGTATTTGTTCCTGAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-315s1c1
Sequence:CCGGCCAGATCGAAATGAAAGTGATCTCGAGATCACTTTCATTTCGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-291s1c1
Sequence:CCGGCATGGTTCAGAGTATTGAGTTCTCGAGAACTCAATACTCTGAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-300s1c1
Sequence:CCGGGAGTATTGAGTTCACCCAGATCTCGAGATCTGGGTGAACTCAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-219s1c1
Sequence:CCGGGCTGCTCAAGAAGAAGCGATACTCGAGTATCGCTTCTTCTTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-565s1c1
Sequence:CCGGCTTCCTGAGAAGATCCCAGAACTCGAGTTCTGGGATCTTCTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-376s1c1
Sequence:CCGGCACCAGGTGATGTCCATTGAACTCGAGTTCAATGGACATCACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-532s1c1
Sequence:CCGGCAAATAGAGCTGCCAGAGGTTCTCGAGAACCTCTGGCAGCTCTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-164s21c1
Sequence:CCGGAGCTGAGGCAGTACCAGAAGACTCGAGTCTTCTGGTACTGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-563s21c1
Sequence:GTACCGGCAATCACTCAGGAACAAATAGCTCGAGCTATTTGTTCCTGAGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024591.4-129s21c1
Sequence:CCGGCAAGGCCATCCTGCAACTGAACTCGAGTTCAGTTGCAGGATGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-890s21c1
Sequence:CCGGCCTGCTCTCAGTCCGGATTAACTCGAGTTAATCCGGACTGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024591.4-478s21c1
Sequence:CCGGGTGGAGTACCAGCGGCAAATACTCGAGTATTTGCCGCTGGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024591
VALIDATED
CHMP6 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 6
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-526s1c1
Sequence:CCGGCAGGAACAAATAGAGCTGCCACTCGAGTGGCAGCTCTATTTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-515s1c1
Sequence:CCGGGCGCAATCACTCAGGAACAAACTCGAGTTTGTTCCTGAGTGATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024591.2-222s1c1
Sequence:CCGGGCTCAAGAAGAAGCGATACCACTCGAGTGGTATCGCTTCTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-345s1c1
Sequence:CCGGGCAGTTTGGAAATGAGTGTCTCTCGAGAGACACTCATTTCCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-318s1c1
Sequence:CCGGGATCGAAATGAAAGTGATGGACTCGAGTCCATCACTTTCATTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-517s1c1
Sequence:CCGGGCAATCACTCAGGAACAAATACTCGAGTATTTGTTCCTGAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-315s1c1
Sequence:CCGGCCAGATCGAAATGAAAGTGATCTCGAGATCACTTTCATTTCGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-291s1c1
Sequence:CCGGCATGGTTCAGAGTATTGAGTTCTCGAGAACTCAATACTCTGAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-300s1c1
Sequence:CCGGGAGTATTGAGTTCACCCAGATCTCGAGATCTGGGTGAACTCAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-219s1c1
Sequence:CCGGGCTGCTCAAGAAGAAGCGATACTCGAGTATCGCTTCTTCTTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-565s1c1
Sequence:CCGGCTTCCTGAGAAGATCCCAGAACTCGAGTTCTGGGATCTTCTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-376s1c1
Sequence:CCGGCACCAGGTGATGTCCATTGAACTCGAGTTCAATGGACATCACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-532s1c1
Sequence:CCGGCAAATAGAGCTGCCAGAGGTTCTCGAGAACCTCTGGCAGCTCTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-164s21c1
Sequence:CCGGAGCTGAGGCAGTACCAGAAGACTCGAGTCTTCTGGTACTGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-563s21c1
Sequence:GTACCGGCAATCACTCAGGAACAAATAGCTCGAGCTATTTGTTCCTGAGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024591.4-129s21c1
Sequence:CCGGCAAGGCCATCCTGCAACTGAACTCGAGTTCAGTTGCAGGATGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-890s21c1
Sequence:CCGGCCTGCTCTCAGTCCGGATTAACTCGAGTTAATCCGGACTGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024591.4-478s21c1
Sequence:CCGGGTGGAGTACCAGCGGCAAATACTCGAGTATTTGCCGCTGGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024591
VALIDATED
CHMP6 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 6
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-526s1c1
Sequence:CCGGCAGGAACAAATAGAGCTGCCACTCGAGTGGCAGCTCTATTTGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-515s1c1
Sequence:CCGGGCGCAATCACTCAGGAACAAACTCGAGTTTGTTCCTGAGTGATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024591.2-222s1c1
Sequence:CCGGGCTCAAGAAGAAGCGATACCACTCGAGTGGTATCGCTTCTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-345s1c1
Sequence:CCGGGCAGTTTGGAAATGAGTGTCTCTCGAGAGACACTCATTTCCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-318s1c1
Sequence:CCGGGATCGAAATGAAAGTGATGGACTCGAGTCCATCACTTTCATTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-517s1c1
Sequence:CCGGGCAATCACTCAGGAACAAATACTCGAGTATTTGTTCCTGAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-315s1c1
Sequence:CCGGCCAGATCGAAATGAAAGTGATCTCGAGATCACTTTCATTTCGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-291s1c1
Sequence:CCGGCATGGTTCAGAGTATTGAGTTCTCGAGAACTCAATACTCTGAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-300s1c1
Sequence:CCGGGAGTATTGAGTTCACCCAGATCTCGAGATCTGGGTGAACTCAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024591.2-219s1c1
Sequence:CCGGGCTGCTCAAGAAGAAGCGATACTCGAGTATCGCTTCTTCTTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-565s1c1
Sequence:CCGGCTTCCTGAGAAGATCCCAGAACTCGAGTTCTGGGATCTTCTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-376s1c1
Sequence:CCGGCACCAGGTGATGTCCATTGAACTCGAGTTCAATGGACATCACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024591.2-532s1c1
Sequence:CCGGCAAATAGAGCTGCCAGAGGTTCTCGAGAACCTCTGGCAGCTCTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-164s21c1
Sequence:CCGGAGCTGAGGCAGTACCAGAAGACTCGAGTCTTCTGGTACTGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-563s21c1
Sequence:GTACCGGCAATCACTCAGGAACAAATAGCTCGAGCTATTTGTTCCTGAGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024591.4-129s21c1
Sequence:CCGGCAAGGCCATCCTGCAACTGAACTCGAGTTCAGTTGCAGGATGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024591.4-890s21c1
Sequence:CCGGCCTGCTCTCAGTCCGGATTAACTCGAGTTAATCCGGACTGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024591.4-478s21c1
Sequence:CCGGGTGGAGTACCAGCGGCAAATACTCGAGTATTTGCCGCTGGTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085498
VALIDATED
CHMP6 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-534s21c1
Sequence:CCGGCTGGAAGAGCTGAATGCAATCCTCGAGGATTGCATTCAGCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-648s21c1
Sequence:CCGGGAGCTGGTGGCGGCTTCATAACTCGAGTTATGAAGCCGCCACCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085498.2-149s21c1
Sequence:CCGGCAAACTGAGGCAGTACCAGAACTCGAGTTCTGGTACTGCCTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-1217s21c1
Sequence:CCGGCATCCCACAGAATGGACAAATCTCGAGATTTGTCCATTCTGTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-573s21c1
Sequence:CCGGTTACCAGAGGTTCCGTCAGAGCTCGAGCTCTGACGGAACCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085498
VALIDATED
CHMP6 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-534s21c1
Sequence:CCGGCTGGAAGAGCTGAATGCAATCCTCGAGGATTGCATTCAGCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-648s21c1
Sequence:CCGGGAGCTGGTGGCGGCTTCATAACTCGAGTTATGAAGCCGCCACCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085498.2-149s21c1
Sequence:CCGGCAAACTGAGGCAGTACCAGAACTCGAGTTCTGGTACTGCCTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-1217s21c1
Sequence:CCGGCATCCCACAGAATGGACAAATCTCGAGATTTGTCCATTCTGTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-573s21c1
Sequence:CCGGTTACCAGAGGTTCCGTCAGAGCTCGAGCTCTGACGGAACCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085498
VALIDATED
CHMP6 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-534s21c1
Sequence:CCGGCTGGAAGAGCTGAATGCAATCCTCGAGGATTGCATTCAGCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-648s21c1
Sequence:CCGGGAGCTGGTGGCGGCTTCATAACTCGAGTTATGAAGCCGCCACCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085498.2-149s21c1
Sequence:CCGGCAAACTGAGGCAGTACCAGAACTCGAGTTCTGGTACTGCCTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-1217s21c1
Sequence:CCGGCATCCCACAGAATGGACAAATCTCGAGATTTGTCCATTCTGTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001085498.2-573s21c1
Sequence:CCGGTTACCAGAGGTTCCGTCAGAGCTCGAGCTCTGACGGAACCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks