EMAIL THIS PAGE TO A FRIEND

CHMP7

charged multivesicular body protein 7

160 Gene Product Result for
UniProtKB ID: Q8WUX9, B2RDT3, D3DSS1, Q8NDM1, Q9BT50
Gene ID:
Mouse(105513) charged multivesicular body protein 7
Rat(364419) charged multivesicular body protein 7
Zebrafish(393754) CHMP family, member 7
cow(541288) charged multivesicular body protein 7
Horse(100053928) charged multivesicular body protein 7
domestic cat(101084355) charged multivesicular body protein 7
chicken(419535) charged multivesicular body protein 7
dog(608924) charged multivesicular body protein 7
sheep(101113461) charged multivesicular body protein 7
naked mole-rat(101698850) charged multivesicular body protein 7
domestic guinea pig(100730970) charged multivesicular body protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036119 Anti-CHMP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152272 Rosetta Predictions human pricing
NM_001108872 Rosetta Predictions rat pricing
NM_134078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365794 predicted 1956
2 SASI_Hs01_00223459 predicted 1197
3 SASI_Hs02_00365795 predicted 1927
4 SASI_Hs02_00365796 predicted 1868
5 SASI_Hs02_00365797 predicted 1893
6 SASI_Hs02_00365798 predicted 950
7 SASI_Hs02_00365799 predicted 1358
8 SASI_Hs02_00365800 predicted 1448
9 SASI_Hs02_00365801 predicted 1208
10 SASI_Hs02_00365802 predicted 1284
11 SASI_Hs01_00223453 predicted 2274
12 SASI_Hs01_00223454 predicted 1319
13 SASI_Hs01_00223455 predicted 1735
14 SASI_Hs01_00223456 predicted 857
15 SASI_Hs01_00223457 predicted 2461
16 SASI_Hs01_00223458 predicted 953
17 SASI_Hs01_00223460 predicted 1318
18 SASI_Hs01_00223461 predicted 2402
19 SASI_Hs01_00223462 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242915 predicted 1460
2 SASI_Rn02_00242916 predicted 1503
3 SASI_Rn02_00242917 predicted 579
4 SASI_Rn02_00242918 predicted 1391
5 SASI_Rn02_00242919 predicted 1078
6 SASI_Rn02_00242920 predicted 1292
7 SASI_Rn02_00242921 predicted 1368
8 SASI_Rn02_00242922 predicted 1196
9 SASI_Rn02_00242923 predicted 1530
10 SASI_Rn02_00242924 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148320 predicted 1346
2 SASI_Mm01_00148321 predicted 528
3 SASI_Mm01_00148322 predicted 1318
4 SASI_Mm01_00148323 predicted 1251
5 SASI_Mm01_00148324 predicted 1252
6 SASI_Mm01_00148325 predicted 1026
7 SASI_Mm02_00339287 predicted 807
8 SASI_Mm01_00148326 predicted 1372
9 SASI_Mm01_00148327 predicted 1139
10 SASI_Mm02_00339288 predicted 1458
11 SASI_Mm01_00148328 predicted 461
12 SASI_Mm01_00148329 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152272
VALIDATED
CHMP7 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 7
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1230s21c1
Sequence:CCGGGAGGACCTTCTACTTGGTGTTCTCGAGAACACCAAGTAGAAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1980s21c1
Sequence:CCGGGCAATTGGAACCGACTCTAAACTCGAGTTTAGAGTCGGTTCCAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1918s21c1
Sequence:CCGGGAACTTGAGAAACTGTCCTTACTCGAGTAAGGACAGTTTCTCAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1903s21c1
Sequence:CCGGGCTGAACTTGAAGCTGAACTTCTCGAGAAGTTCAGCTTCAAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-146s1c1
Sequence:CCGGCTTCCTGTTCTCCGCTTTCAACTCGAGTTGAAAGCGGAGAACAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1320s1c1
Sequence:CCGGGAACTTGAGAAACTGTCCTTACTCGAGTAAGGACAGTTTCTCAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1305s1c1
Sequence:CCGGGCTGAACTTGAAGCTGAACTTCTCGAGAAGTTCAGCTTCAAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1382s1c1
Sequence:CCGGGCAATTGGAACCGACTCTAAACTCGAGTTTAGAGTCGGTTCCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-747s1c1
Sequence:CCGGCCAGTCAATGACGTAGATGTTCTCGAGAACATCTACGTCATTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-1212s1c1
Sequence:CCGGCTTCAGGATACCACCAAAGAACTCGAGTTCTTTGGTGGTATCCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-453s1c1
Sequence:CCGGCTTTCTAACATGCTGGGAGATCTCGAGATCTCCCAGCATGTTAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-828s1c1
Sequence:CCGGCAGGAAGCAGAGAGGTGTAAACTCGAGTTTACACCTCTCTGCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152272.1-1284s1c1
Sequence:CCGGCCTAACCCTAGGATCTCAGATCTCGAGATCTGAGATCCTAGGGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-531s1c1
Sequence:CCGGGAGGAGGTGTATCGTCTGTATCTCGAGATACAGACGATACACCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-632s1c1
Sequence:CCGGGAGGACCTTCTACTTGGTGTTCTCGAGAACACCAAGTAGAAGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152272
VALIDATED
CHMP7 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 7
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1230s21c1
Sequence:CCGGGAGGACCTTCTACTTGGTGTTCTCGAGAACACCAAGTAGAAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1980s21c1
Sequence:CCGGGCAATTGGAACCGACTCTAAACTCGAGTTTAGAGTCGGTTCCAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1918s21c1
Sequence:CCGGGAACTTGAGAAACTGTCCTTACTCGAGTAAGGACAGTTTCTCAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1903s21c1
Sequence:CCGGGCTGAACTTGAAGCTGAACTTCTCGAGAAGTTCAGCTTCAAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-146s1c1
Sequence:CCGGCTTCCTGTTCTCCGCTTTCAACTCGAGTTGAAAGCGGAGAACAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1320s1c1
Sequence:CCGGGAACTTGAGAAACTGTCCTTACTCGAGTAAGGACAGTTTCTCAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1305s1c1
Sequence:CCGGGCTGAACTTGAAGCTGAACTTCTCGAGAAGTTCAGCTTCAAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1382s1c1
Sequence:CCGGGCAATTGGAACCGACTCTAAACTCGAGTTTAGAGTCGGTTCCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-747s1c1
Sequence:CCGGCCAGTCAATGACGTAGATGTTCTCGAGAACATCTACGTCATTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-1212s1c1
Sequence:CCGGCTTCAGGATACCACCAAAGAACTCGAGTTCTTTGGTGGTATCCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-453s1c1
Sequence:CCGGCTTTCTAACATGCTGGGAGATCTCGAGATCTCCCAGCATGTTAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-828s1c1
Sequence:CCGGCAGGAAGCAGAGAGGTGTAAACTCGAGTTTACACCTCTCTGCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152272.1-1284s1c1
Sequence:CCGGCCTAACCCTAGGATCTCAGATCTCGAGATCTGAGATCCTAGGGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-531s1c1
Sequence:CCGGGAGGAGGTGTATCGTCTGTATCTCGAGATACAGACGATACACCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-632s1c1
Sequence:CCGGGAGGACCTTCTACTTGGTGTTCTCGAGAACACCAAGTAGAAGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152272
VALIDATED
CHMP7 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 7
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1230s21c1
Sequence:CCGGGAGGACCTTCTACTTGGTGTTCTCGAGAACACCAAGTAGAAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1980s21c1
Sequence:CCGGGCAATTGGAACCGACTCTAAACTCGAGTTTAGAGTCGGTTCCAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1918s21c1
Sequence:CCGGGAACTTGAGAAACTGTCCTTACTCGAGTAAGGACAGTTTCTCAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152272.3-1903s21c1
Sequence:CCGGGCTGAACTTGAAGCTGAACTTCTCGAGAAGTTCAGCTTCAAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-146s1c1
Sequence:CCGGCTTCCTGTTCTCCGCTTTCAACTCGAGTTGAAAGCGGAGAACAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1320s1c1
Sequence:CCGGGAACTTGAGAAACTGTCCTTACTCGAGTAAGGACAGTTTCTCAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1305s1c1
Sequence:CCGGGCTGAACTTGAAGCTGAACTTCTCGAGAAGTTCAGCTTCAAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-1382s1c1
Sequence:CCGGGCAATTGGAACCGACTCTAAACTCGAGTTTAGAGTCGGTTCCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-747s1c1
Sequence:CCGGCCAGTCAATGACGTAGATGTTCTCGAGAACATCTACGTCATTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-1212s1c1
Sequence:CCGGCTTCAGGATACCACCAAAGAACTCGAGTTCTTTGGTGGTATCCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-453s1c1
Sequence:CCGGCTTTCTAACATGCTGGGAGATCTCGAGATCTCCCAGCATGTTAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-828s1c1
Sequence:CCGGCAGGAAGCAGAGAGGTGTAAACTCGAGTTTACACCTCTCTGCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152272.1-1284s1c1
Sequence:CCGGCCTAACCCTAGGATCTCAGATCTCGAGATCTGAGATCCTAGGGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152272.1-531s1c1
Sequence:CCGGGAGGAGGTGTATCGTCTGTATCTCGAGATACAGACGATACACCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152272.1-632s1c1
Sequence:CCGGGAGGACCTTCTACTTGGTGTTCTCGAGAACACCAAGTAGAAGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134078
VALIDATED
CHMP7 MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134078.2-2158s1c1
Sequence:CCGGCCCATTATAAAGGATGTGTTTCTCGAGAAACACATCCTTTATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-1172s1c1
Sequence:CCGGGAGTAACCAATGGTTTAGATTCTCGAGAATCTAAACCATTGGTTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-462s1c1
Sequence:CCGGCAAGTGGACTCTTTCTAACATCTCGAGATGTTAGAAAGAGTCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-459s1c1
Sequence:CCGGCCTCAAGTGGACTCTTTCTAACTCGAGTTAGAAAGAGTCCACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-1380s1c1
Sequence:CCGGCCCAAGCAGTAAATCTCCAAACTCGAGTTTGGAGATTTACTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134078
VALIDATED
CHMP7 MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134078.2-2158s1c1
Sequence:CCGGCCCATTATAAAGGATGTGTTTCTCGAGAAACACATCCTTTATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-1172s1c1
Sequence:CCGGGAGTAACCAATGGTTTAGATTCTCGAGAATCTAAACCATTGGTTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-462s1c1
Sequence:CCGGCAAGTGGACTCTTTCTAACATCTCGAGATGTTAGAAAGAGTCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-459s1c1
Sequence:CCGGCCTCAAGTGGACTCTTTCTAACTCGAGTTAGAAAGAGTCCACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-1380s1c1
Sequence:CCGGCCCAAGCAGTAAATCTCCAAACTCGAGTTTGGAGATTTACTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134078
VALIDATED
CHMP7 MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134078.2-2158s1c1
Sequence:CCGGCCCATTATAAAGGATGTGTTTCTCGAGAAACACATCCTTTATAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-1172s1c1
Sequence:CCGGGAGTAACCAATGGTTTAGATTCTCGAGAATCTAAACCATTGGTTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-462s1c1
Sequence:CCGGCAAGTGGACTCTTTCTAACATCTCGAGATGTTAGAAAGAGTCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-459s1c1
Sequence:CCGGCCTCAAGTGGACTCTTTCTAACTCGAGTTAGAAAGAGTCCACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134078.2-1380s1c1
Sequence:CCGGCCCAAGCAGTAAATCTCCAAACTCGAGTTTGGAGATTTACTGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)