EMAIL THIS PAGE TO A FRIEND

CHN1

chimerin 1

136 Gene Product Result for
Synonyms: ARHGAP2 CHN DURS2 NC RHOGAP2
Gene ID:
Human(1123) Summary: This gene encodes GTPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. Mutations in this gene are associated with Duane's retraction syndrome 2 (DURS2). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Mouse(108699) chimerin (chimaerin) 1
Rat(84030) chimerin (chimaerin) 1
Zebrafish(406273) chimerin (chimaerin) 1
cow(508266) chimerin (chimaerin) 1
Horse(100065187) chimerin 1
dog(478805) chimerin (chimaerin) 1
chicken(429021) chimerin (chimaerin) 1
sheep(101109591) chimerin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001822 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025201 Rosetta Predictions human pricing
NM_001822 Rosetta Predictions human pricing
NM_032083 Rosetta Predictions rat pricing
XM_579545 Rosetta Predictions rat pricing
NM_001113246 Rosetta Predictions mouse pricing
NM_029716 Rosetta Predictions mouse pricing
NM_175752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307407 predicted 1084
2 SASI_Hs02_00307408 predicted 1227
3 SASI_Hs01_00241466 predicted 1224
4 SASI_Hs01_00241467 predicted 998
5 SASI_Hs01_00241468 predicted 1056
6 SASI_Hs01_00241469 predicted 1389
7 SASI_Hs01_00241470 predicted 1152
8 SASI_Hs01_00241472 predicted 1111
9 SASI_Hs02_00307409 predicted 844
10 SASI_Hs01_00241473 predicted 1390
11 SASI_Hs01_00241471 predicted 677
12 SASI_Hs01_00241474 predicted 961
13 SASI_Hs01_00241475 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332607 predicted 1210
2 SASI_Hs02_00332608 predicted 1355
3 SASI_Hs01_00146792 predicted 1348
4 SASI_Hs01_00146793 predicted 1129
5 SASI_Hs01_00146794 predicted 1183
6 SASI_Hs01_00146795 predicted 1508
7 SASI_Hs01_00146796 predicted 1278
8 SASI_Hs01_00146798 predicted 1239
9 SASI_Hs02_00332609 predicted 964
10 SASI_Hs01_00146799 predicted 1515
11 SASI_Hs01_00146797 predicted 796
12 SASI_Hs01_00146800 predicted 1096
13 SASI_Hs01_00146801 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265463 predicted 745
2 SASI_Rn02_00265464 predicted 1095
3 SASI_Rn02_00265465 predicted 1020
4 SASI_Rn02_00265466 predicted 957
5 SASI_Rn02_00265467 predicted 1491
6 SASI_Rn02_00265468 predicted 1473
7 SASI_Rn01_00051340 predicted 1051
8 SASI_Rn02_00265469 predicted 1353
9 SASI_Rn01_00051341 predicted 828
10 SASI_Rn02_00265470 predicted 753
11 SASI_Rn01_00051338 predicted 1131
12 SASI_Rn01_00051339 predicted 1022
13 SASI_Rn01_00051342 predicted 1078
14 SASI_Rn01_00051343 predicted 837
15 SASI_Rn01_00051344 predicted 657
16 SASI_Rn01_00051345 predicted 456
17 SASI_Rn01_00051346 predicted 580
18 SASI_Rn01_00051347 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194917 predicted 1126
2 SASI_Rn01_00194918 predicted 838
3 SASI_Rn01_00194919 predicted 838
4 SASI_Rn01_00194920 predicted 1015
5 SASI_Rn01_00194921 predicted 1011
6 SASI_Rn01_00194922 predicted 1044
7 SASI_Rn01_00194923 predicted 827
8 SASI_Rn01_00194924 predicted 1191
9 SASI_Rn01_00194925 predicted 1075
10 SASI_Rn01_00194926 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307303 predicted 1260
2 SASI_Mm02_00307304 predicted 1307
3 SASI_Mm02_00307305 predicted 1269
4 SASI_Mm02_00307306 predicted 1263
5 SASI_Mm02_00307307 predicted 1260
6 SASI_Mm02_00307308 predicted 1279
7 SASI_Mm02_00307309 predicted 1299
8 SASI_Mm02_00307310 predicted 1312
9 SASI_Mm02_00307311 predicted 1265
10 SASI_Mm02_00307312 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193110 predicted 708
2 SASI_Mm01_00193111 predicted 752
3 SASI_Mm01_00193112 predicted 718
4 SASI_Mm01_00193113 predicted 715
5 SASI_Mm01_00193114 predicted 706
6 SASI_Mm01_00193115 predicted 729
7 SASI_Mm01_00193116 predicted 750
8 SASI_Mm01_00193117 predicted 761
9 SASI_Mm01_00193118 predicted 718
10 SASI_Mm01_00193119 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123362 predicted 1263
2 SASI_Mm01_00123363 predicted 1309
3 SASI_Mm01_00123364 predicted 1272
4 SASI_Mm01_00123365 predicted 1266
5 SASI_Mm01_00123366 predicted 1258
6 SASI_Mm01_00123367 predicted 1280
7 SASI_Mm01_00123368 predicted 1299
8 SASI_Mm01_00123369 predicted 1313
9 SASI_Mm01_00123370 predicted 1266
10 SASI_Mm01_00123371 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175752
VALIDATED
CHN1 MISSION shRNA Bacterial Glycerol Stock
chimerin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175752.1-3204s1c1
Sequence:CCGGGCCTAATATGTGCAAAGGATTCTCGAGAATCCTTTGCACATATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-1370s1c1
Sequence:CCGGGCCCTGAACGACATACGCTATCTCGAGATAGCGTATGTCGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-756s1c1
Sequence:CCGGAGGGAGTGAAATGTGCAGATTCTCGAGAATCTGCACATTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-615s1c1
Sequence:CCGGCATCACTTGTTAGAAGAGCAACTCGAGTTGCTCTTCTAACAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-1033s1c1
Sequence:CCGGGAAGGCGGATATTTCTGTGAACTCGAGTTCACAGAAATATCCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175752
VALIDATED
CHN1 MISSION shRNA shRNA Plasmid DNA
chimerin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175752.1-3204s1c1
Sequence:CCGGGCCTAATATGTGCAAAGGATTCTCGAGAATCCTTTGCACATATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-1370s1c1
Sequence:CCGGGCCCTGAACGACATACGCTATCTCGAGATAGCGTATGTCGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-756s1c1
Sequence:CCGGAGGGAGTGAAATGTGCAGATTCTCGAGAATCTGCACATTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-615s1c1
Sequence:CCGGCATCACTTGTTAGAAGAGCAACTCGAGTTGCTCTTCTAACAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-1033s1c1
Sequence:CCGGGAAGGCGGATATTTCTGTGAACTCGAGTTCACAGAAATATCCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175752
VALIDATED
CHN1 MISSION shRNA Lentiviral Transduction Particles
chimerin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175752.1-3204s1c1
Sequence:CCGGGCCTAATATGTGCAAAGGATTCTCGAGAATCCTTTGCACATATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-1370s1c1
Sequence:CCGGGCCCTGAACGACATACGCTATCTCGAGATAGCGTATGTCGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-756s1c1
Sequence:CCGGAGGGAGTGAAATGTGCAGATTCTCGAGAATCTGCACATTTCACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-615s1c1
Sequence:CCGGCATCACTTGTTAGAAGAGCAACTCGAGTTGCTCTTCTAACAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175752.1-1033s1c1
Sequence:CCGGGAAGGCGGATATTTCTGTGAACTCGAGTTCACAGAAATATCCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001822
VALIDATED
CHN1 MISSION shRNA Bacterial Glycerol Stock
chimerin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1389s1c1
Sequence:CCGGCCTACCCTAAGTTTATAGAATCTCGAGATTCTATAAACTTAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-745s1c1
Sequence:CCGGGCACGTAGGATACACAACCTTCTCGAGAAGGTTGTGTATCCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1622s1c1
Sequence:CCGGGCATTGAATGATATACGGTATCTCGAGATACCGTATATCATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001822.2-566s1c1
Sequence:CCGGGCTTTAAGATTTGGAAGTCAACTCGAGTTGACTTCCAAATCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1209s1c1
Sequence:CCGGCTGAAGGACTATACCGAGTATCTCGAGATACTCGGTATAGTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1426s21c1
Sequence:CCGGCTGAAGGACTATACCGAGTATCTCGAGATACTCGGTATAGTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1839s21c1
Sequence:CCGGGCATTGAATGATATACGGTATCTCGAGATACCGTATATCATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1606s21c1
Sequence:CCGGCCTACCCTAAGTTTATAGAATCTCGAGATTCTATAAACTTAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-962s21c1
Sequence:CCGGGCACGTAGGATACACAACCTTCTCGAGAAGGTTGTGTATCCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001822
VALIDATED
CHN1 MISSION shRNA shRNA Plasmid DNA
chimerin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1389s1c1
Sequence:CCGGCCTACCCTAAGTTTATAGAATCTCGAGATTCTATAAACTTAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-745s1c1
Sequence:CCGGGCACGTAGGATACACAACCTTCTCGAGAAGGTTGTGTATCCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1622s1c1
Sequence:CCGGGCATTGAATGATATACGGTATCTCGAGATACCGTATATCATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001822.2-566s1c1
Sequence:CCGGGCTTTAAGATTTGGAAGTCAACTCGAGTTGACTTCCAAATCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1209s1c1
Sequence:CCGGCTGAAGGACTATACCGAGTATCTCGAGATACTCGGTATAGTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1426s21c1
Sequence:CCGGCTGAAGGACTATACCGAGTATCTCGAGATACTCGGTATAGTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1839s21c1
Sequence:CCGGGCATTGAATGATATACGGTATCTCGAGATACCGTATATCATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1606s21c1
Sequence:CCGGCCTACCCTAAGTTTATAGAATCTCGAGATTCTATAAACTTAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-962s21c1
Sequence:CCGGGCACGTAGGATACACAACCTTCTCGAGAAGGTTGTGTATCCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001822
VALIDATED
CHN1 MISSION shRNA Lentiviral Transduction Particles
chimerin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1389s1c1
Sequence:CCGGCCTACCCTAAGTTTATAGAATCTCGAGATTCTATAAACTTAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-745s1c1
Sequence:CCGGGCACGTAGGATACACAACCTTCTCGAGAAGGTTGTGTATCCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1622s1c1
Sequence:CCGGGCATTGAATGATATACGGTATCTCGAGATACCGTATATCATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001822.2-566s1c1
Sequence:CCGGGCTTTAAGATTTGGAAGTCAACTCGAGTTGACTTCCAAATCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001822.2-1209s1c1
Sequence:CCGGCTGAAGGACTATACCGAGTATCTCGAGATACTCGGTATAGTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1426s21c1
Sequence:CCGGCTGAAGGACTATACCGAGTATCTCGAGATACTCGGTATAGTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1839s21c1
Sequence:CCGGGCATTGAATGATATACGGTATCTCGAGATACCGTATATCATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-1606s21c1
Sequence:CCGGCCTACCCTAAGTTTATAGAATCTCGAGATTCTATAAACTTAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001822.4-962s21c1
Sequence:CCGGGCACGTAGGATACACAACCTTCTCGAGAAGGTTGTGTATCCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks