EMAIL THIS PAGE TO A FRIEND

CHN2

chimerin 2

179 Gene Product Result for
Synonyms: ARHGAP3 BCH CHN2-3 RHOGAP3
Gene ID:
Human(1124) Summary: This gene is a member of the chimerin family and encodes a protein with a phorbol-ester/DAG-type zinc finger, a Rho-GAP domain and an SH2 domain. This protein has GTPase-activating protein activity that is regulated by phospholipid binding and binding of diacylglycerol (DAG) induces translocation of the protein from the cytosol to the Golgi apparatus membrane. The protein plays a role in the proliferation and migration of smooth muscle cells. Decreased expression of this gene is associated with high-grade gliomas and breast tumors, and increased expression of this gene is associated with lymphomas. Mutations in this gene have been associated with schizophrenia in men. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(69993) chimerin (chimaerin) 2
Rat(84031) chimerin 2
sheep(101103716) chimerin 2
Zebrafish(570999) chimerin (chimaerin) 2
chicken(428437) chimerin (chimaerin) 2
dog(475267) chimerin 2
cow(507285) chimerin (chimaerin) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004067 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039936 Rosetta Predictions human pricing
NM_004067 Rosetta Predictions human pricing
NM_032084 Rosetta Predictions rat pricing
XM_579546 Rosetta Predictions rat pricing
NM_023543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075622 predicted 1169
2 SASI_Hs01_00075623 predicted 653
3 SASI_Hs01_00075624 predicted 1173
4 SASI_Hs01_00075625 predicted 880
5 SASI_Hs01_00075626 predicted 899
6 SASI_Hs01_00075627 predicted 611
7 SASI_Hs01_00075628 predicted 1310
8 SASI_Hs01_00075629 predicted 832
9 SASI_Hs01_00075630 predicted 913
10 SASI_Hs01_00075631 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104071 predicted 1774
2 SASI_Hs01_00104072 predicted 1254
3 SASI_Hs01_00104073 predicted 1776
4 SASI_Hs01_00104074 predicted 1488
5 SASI_Hs01_00104075 predicted 1500
6 SASI_Hs01_00104076 predicted 1217
7 SASI_Hs01_00104077 predicted 1909
8 SASI_Hs01_00104078 predicted 1434
9 SASI_Hs01_00104079 predicted 1518
10 SASI_Hs01_00104080 predicted 1875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100538 predicted 290
2 SASI_Rn01_00100539 predicted 523
3 SASI_Rn01_00100540 predicted 253
4 SASI_Rn01_00100541 predicted 284
5 SASI_Rn01_00100543 predicted 645
6 SASI_Rn01_00100544 predicted 438
7 SASI_Rn01_00100545 predicted 474
8 SASI_Rn01_00100546 predicted 736
9 SASI_Rn01_00100547 predicted 651
10 SASI_Rn02_00265471 predicted 537
11 SASI_Rn01_00100542 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149778 predicted 224
2 SASI_Rn01_00149779 predicted 467
3 SASI_Rn01_00149780 predicted 223
4 SASI_Rn01_00149781 predicted 376
5 SASI_Rn01_00149782 predicted 407
6 SASI_Rn01_00149783 predicted 401
7 SASI_Rn01_00149784 predicted 376
8 SASI_Rn01_00149785 predicted 313
9 SASI_Rn01_00149786 predicted 411
10 SASI_Rn01_00149787 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047360 predicted 552
2 SASI_Mm01_00047362 predicted 692
3 SASI_Mm02_00327182 predicted 559
4 SASI_Mm01_00047363 predicted 311
5 SASI_Mm01_00047364 predicted 413
6 SASI_Mm01_00047365 predicted 316
7 SASI_Mm01_00047366 predicted 765
8 SASI_Mm01_00047367 predicted 929
9 SASI_Mm01_00047368 predicted 423
10 SASI_Mm01_00047369 predicted 473
11 SASI_Mm01_00047361 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023543
VALIDATED
CHN2 MISSION shRNA Bacterial Glycerol Stock
chimerin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-411s21c1
Sequence:CCGGGTGTTCAGATTGTGGGTTAAACTCGAGTTTAACCCACAATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023543.1-1274s21c1
Sequence:CCGGGCCTCGTATGTATGTCTGTTTCTCGAGAAACAGACATACATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-774s21c1
Sequence:CCGGATATGACACCTACTCCAAATTCTCGAGAATTTGGAGTAGGTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-560s21c1
Sequence:CCGGTGGACATATGTATTCGGGAAACTCGAGTTTCCCGAATACATATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-695s21c1
Sequence:CCGGCCAACATCTACCCAGACATAACTCGAGTTATGTCTGGGTAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-432s1c1
Sequence:CCGGCGTACACAAACAGTGCTCCAACTCGAGTTGGAGCACTGTTTGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-560s1c1
Sequence:CCGGTGGACATATGTATTCGGGAAACTCGAGTTTCCCGAATACATATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-1274s1c1
Sequence:CCGGGCCTCGTATGTATGTCTGTTTCTCGAGAAACAGACATACATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-411s1c1
Sequence:CCGGGTGTTCAGATTGTGGGTTAAACTCGAGTTTAACCCACAATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-695s1c1
Sequence:CCGGCCAACATCTACCCAGACATAACTCGAGTTATGTCTGGGTAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023543
VALIDATED
CHN2 MISSION shRNA shRNA Plasmid DNA
chimerin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-411s21c1
Sequence:CCGGGTGTTCAGATTGTGGGTTAAACTCGAGTTTAACCCACAATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023543.1-1274s21c1
Sequence:CCGGGCCTCGTATGTATGTCTGTTTCTCGAGAAACAGACATACATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-774s21c1
Sequence:CCGGATATGACACCTACTCCAAATTCTCGAGAATTTGGAGTAGGTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-560s21c1
Sequence:CCGGTGGACATATGTATTCGGGAAACTCGAGTTTCCCGAATACATATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-695s21c1
Sequence:CCGGCCAACATCTACCCAGACATAACTCGAGTTATGTCTGGGTAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-432s1c1
Sequence:CCGGCGTACACAAACAGTGCTCCAACTCGAGTTGGAGCACTGTTTGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-560s1c1
Sequence:CCGGTGGACATATGTATTCGGGAAACTCGAGTTTCCCGAATACATATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-1274s1c1
Sequence:CCGGGCCTCGTATGTATGTCTGTTTCTCGAGAAACAGACATACATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-411s1c1
Sequence:CCGGGTGTTCAGATTGTGGGTTAAACTCGAGTTTAACCCACAATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-695s1c1
Sequence:CCGGCCAACATCTACCCAGACATAACTCGAGTTATGTCTGGGTAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023543
VALIDATED
CHN2 MISSION shRNA Lentiviral Transduction Particles
chimerin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-411s21c1
Sequence:CCGGGTGTTCAGATTGTGGGTTAAACTCGAGTTTAACCCACAATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023543.1-1274s21c1
Sequence:CCGGGCCTCGTATGTATGTCTGTTTCTCGAGAAACAGACATACATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-774s21c1
Sequence:CCGGATATGACACCTACTCCAAATTCTCGAGAATTTGGAGTAGGTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-560s21c1
Sequence:CCGGTGGACATATGTATTCGGGAAACTCGAGTTTCCCGAATACATATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023543.1-695s21c1
Sequence:CCGGCCAACATCTACCCAGACATAACTCGAGTTATGTCTGGGTAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-432s1c1
Sequence:CCGGCGTACACAAACAGTGCTCCAACTCGAGTTGGAGCACTGTTTGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-560s1c1
Sequence:CCGGTGGACATATGTATTCGGGAAACTCGAGTTTCCCGAATACATATGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-1274s1c1
Sequence:CCGGGCCTCGTATGTATGTCTGTTTCTCGAGAAACAGACATACATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-411s1c1
Sequence:CCGGGTGTTCAGATTGTGGGTTAAACTCGAGTTTAACCCACAATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023543.1-695s1c1
Sequence:CCGGCCAACATCTACCCAGACATAACTCGAGTTATGTCTGGGTAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004067
CHN2 MISSION shRNA Bacterial Glycerol Stock
chimerin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-1250s1c1
Sequence:CCGGCCAATGTCTATCCAGACATAACTCGAGTTATGTCTGGATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-1124s1c1
Sequence:CCGGGCATTCGGGAAATTGAAGCAACTCGAGTTGCTTCAATTTCCCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-987s1c1
Sequence:CCGGCGTACACAAACAGTGTTCCAACTCGAGTTGGAACACTGTTTGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-686s1c1
Sequence:CCGGCCATCTATGAACACATTGGATCTCGAGATCCAATGTGTTCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-537s1c1
Sequence:CCGGGACCTTAAACTACAGGCTCTTCTCGAGAAGAGCCTGTAGTTTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004067
CHN2 MISSION shRNA shRNA Plasmid DNA
chimerin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-1250s1c1
Sequence:CCGGCCAATGTCTATCCAGACATAACTCGAGTTATGTCTGGATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-1124s1c1
Sequence:CCGGGCATTCGGGAAATTGAAGCAACTCGAGTTGCTTCAATTTCCCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-987s1c1
Sequence:CCGGCGTACACAAACAGTGTTCCAACTCGAGTTGGAACACTGTTTGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-686s1c1
Sequence:CCGGCCATCTATGAACACATTGGATCTCGAGATCCAATGTGTTCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-537s1c1
Sequence:CCGGGACCTTAAACTACAGGCTCTTCTCGAGAAGAGCCTGTAGTTTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004067
CHN2 MISSION shRNA Lentiviral Transduction Particles
chimerin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-1250s1c1
Sequence:CCGGCCAATGTCTATCCAGACATAACTCGAGTTATGTCTGGATAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-1124s1c1
Sequence:CCGGGCATTCGGGAAATTGAAGCAACTCGAGTTGCTTCAATTTCCCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-987s1c1
Sequence:CCGGCGTACACAAACAGTGTTCCAACTCGAGTTGGAACACTGTTTGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-686s1c1
Sequence:CCGGCCATCTATGAACACATTGGATCTCGAGATCCAATGTGTTCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004067.1-537s1c1
Sequence:CCGGGACCTTAAACTACAGGCTCTTCTCGAGAAGAGCCTGTAGTTTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks