EMAIL THIS PAGE TO A FRIEND

CHODL

chondrolectin

111 Gene Product Result for
Synonyms: C21orf68 MT75
Gene ID:
Human(140578) Summary: This gene encodes a type I membrane protein with a carbohydrate recognition domain characteristic of C-type lectins in its extracellular portion. In other proteins, this domain is involved in endocytosis of glycoproteins and exogenous sugar-bearing pathogens. This protein localizes predominantly to the perinuclear region. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(246048) chondrolectin
Rat(288289) chondrolectin
Zebrafish(550240) chondrolectin
domestic cat(101089132) chondrolectin
cow(613942) chondrolectin
dog(487699) chondrolectin
chicken(418474) chondrolectin
sheep(101115923) chondrolectin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024944 Rosetta Predictions human pricing
NM_001105894 Rosetta Predictions rat pricing
NM_139134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357590 predicted 659
2 SASI_Hs01_00227010 predicted 1022
3 SASI_Hs01_00227011 predicted 1007
4 SASI_Hs01_00227012 predicted 882
5 SASI_Hs01_00227013 predicted 1150
6 SASI_Hs01_00227014 predicted 761
7 SASI_Hs01_00227015 predicted 919
8 SASI_Hs01_00227016 predicted 786
9 SASI_Hs01_00227018 predicted 1192
10 SASI_Hs02_00357591 predicted 672
11 SASI_Hs01_00227009 predicted 909
12 SASI_Hs01_00227017 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213582 predicted 914
2 SASI_Rn02_00213583 predicted 532
3 SASI_Rn02_00213584 predicted 815
4 SASI_Rn02_00213585 predicted 715
5 SASI_Rn02_00213586 predicted 1034
6 SASI_Rn02_00213587 predicted 952
7 SASI_Rn02_00213588 predicted 833
8 SASI_Rn02_00213589 predicted 926
9 SASI_Rn02_00213590 predicted 1006
10 SASI_Rn02_00213591 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157414 predicted 892
2 SASI_Mm01_00157415 predicted 1183
3 SASI_Mm01_00157416 predicted 522
4 SASI_Mm01_00157417 predicted 1034
5 SASI_Mm01_00157418 predicted 638
6 SASI_Mm01_00157419 predicted 1182
7 SASI_Mm01_00157421 predicted 1213
8 SASI_Mm01_00157423 predicted 549
9 SASI_Mm02_00339875 predicted 954
10 SASI_Mm02_00339876 predicted 1084
11 SASI_Mm01_00157420 predicted 782
12 SASI_Mm01_00157422 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024944
CHODL MISSION shRNA Bacterial Glycerol Stock
chondrolectin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-895s1c1
Sequence:CCGGCAGGTGTAACATGAAGCACAACTCGAGTTGTGCTTCATGTTACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024944.2-1019s1c1
Sequence:CCGGGAAGCAGGTATAATTCCCAATCTCGAGATTGGGAATTATACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-924s1c1
Sequence:CCGGGCAAGTATGAACCAGAGATTACTCGAGTAATCTCTGGTTCATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024944.2-2370s1c1
Sequence:CCGGGCATATTCATTGATGAGGGTTCTCGAGAACCCTCATCAATGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-996s1c1
Sequence:CCGGCCCATCAGAATGTGGTTGTTACTCGAGTAACAACCACATTCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024944.2-2453s1c1
Sequence:CCGGCCTTGTTCTTCTCAAGAGAAACTCGAGTTTCTCTTGAGAAGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024944.2-1551s21c1
Sequence:CCGGTAAGTTGTTATCTAGTCAATGCTCGAGCATTGACTAGATAACAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024944
CHODL MISSION shRNA shRNA Plasmid DNA
chondrolectin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-895s1c1
Sequence:CCGGCAGGTGTAACATGAAGCACAACTCGAGTTGTGCTTCATGTTACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024944.2-1019s1c1
Sequence:CCGGGAAGCAGGTATAATTCCCAATCTCGAGATTGGGAATTATACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-924s1c1
Sequence:CCGGGCAAGTATGAACCAGAGATTACTCGAGTAATCTCTGGTTCATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024944.2-2370s1c1
Sequence:CCGGGCATATTCATTGATGAGGGTTCTCGAGAACCCTCATCAATGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-996s1c1
Sequence:CCGGCCCATCAGAATGTGGTTGTTACTCGAGTAACAACCACATTCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024944.2-2453s1c1
Sequence:CCGGCCTTGTTCTTCTCAAGAGAAACTCGAGTTTCTCTTGAGAAGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024944.2-1551s21c1
Sequence:CCGGTAAGTTGTTATCTAGTCAATGCTCGAGCATTGACTAGATAACAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024944
CHODL MISSION shRNA Lentiviral Transduction Particles
chondrolectin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-895s1c1
Sequence:CCGGCAGGTGTAACATGAAGCACAACTCGAGTTGTGCTTCATGTTACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024944.2-1019s1c1
Sequence:CCGGGAAGCAGGTATAATTCCCAATCTCGAGATTGGGAATTATACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-924s1c1
Sequence:CCGGGCAAGTATGAACCAGAGATTACTCGAGTAATCTCTGGTTCATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024944.2-2370s1c1
Sequence:CCGGGCATATTCATTGATGAGGGTTCTCGAGAACCCTCATCAATGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024944.2-996s1c1
Sequence:CCGGCCCATCAGAATGTGGTTGTTACTCGAGTAACAACCACATTCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024944.2-2453s1c1
Sequence:CCGGCCTTGTTCTTCTCAAGAGAAACTCGAGTTTCTCTTGAGAAGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024944.2-1551s21c1
Sequence:CCGGTAAGTTGTTATCTAGTCAATGCTCGAGCATTGACTAGATAACAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139134
CHODL MISSION shRNA Bacterial Glycerol Stock
chondrolectin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-650s1c1
Sequence:CCGGGAACCTTCTTGTGGGAGTGAACTCGAGTTCACTCCCACAAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-632s1c1
Sequence:CCGGCGAAACTGGTACACTGATGAACTCGAGTTCATCAGTGTACCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-876s1c1
Sequence:CCGGCAGGCATAATTCCCAATCTAACTCGAGTTAGATTGGGAATTATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-722s1c1
Sequence:CCGGCCCTACCTTTACCAGTGGAATCTCGAGATTCCACTGGTAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139134.1-1763s1c1
Sequence:CCGGCGTGCCTTACAATTATTCTTACTCGAGTAAGAATAATTGTAAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139134
CHODL MISSION shRNA shRNA Plasmid DNA
chondrolectin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-650s1c1
Sequence:CCGGGAACCTTCTTGTGGGAGTGAACTCGAGTTCACTCCCACAAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-632s1c1
Sequence:CCGGCGAAACTGGTACACTGATGAACTCGAGTTCATCAGTGTACCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-876s1c1
Sequence:CCGGCAGGCATAATTCCCAATCTAACTCGAGTTAGATTGGGAATTATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-722s1c1
Sequence:CCGGCCCTACCTTTACCAGTGGAATCTCGAGATTCCACTGGTAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139134.1-1763s1c1
Sequence:CCGGCGTGCCTTACAATTATTCTTACTCGAGTAAGAATAATTGTAAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139134
CHODL MISSION shRNA Lentiviral Transduction Particles
chondrolectin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-650s1c1
Sequence:CCGGGAACCTTCTTGTGGGAGTGAACTCGAGTTCACTCCCACAAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-632s1c1
Sequence:CCGGCGAAACTGGTACACTGATGAACTCGAGTTCATCAGTGTACCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-876s1c1
Sequence:CCGGCAGGCATAATTCCCAATCTAACTCGAGTTAGATTGGGAATTATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139134.1-722s1c1
Sequence:CCGGCCCTACCTTTACCAGTGGAATCTCGAGATTCCACTGGTAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139134.1-1763s1c1
Sequence:CCGGCGTGCCTTACAATTATTCTTACTCGAGTAAGAATAATTGTAAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks