EMAIL THIS PAGE TO A FRIEND

CHORDC1

cysteine and histidine-rich domain (CHORD) containing 1

63 Gene Product Result for
Synonyms: CHP1
UniProtKB ID: Q9UHD1, B2R6P8, Q6IN49, Q8WVL9, Q9H3D6
Gene ID:
Mouse(66917) cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1
Rat(315447) cysteine and histidine-rich domain (CHORD)-containing 1
Zebrafish(393310) cysteine and histidine-rich domain (CHORD)-containing, zinc binding protein 1
dog(476773) cysteine and histidine-rich domain (CHORD) containing 1
chicken(419009) cysteine and histidine-rich domain (CHORD) containing 1
cow(505144) cysteine and histidine-rich domain (CHORD) containing 1
naked mole-rat(101722059) cysteine and histidine-rich domain (CHORD) containing 1
domestic guinea pig(100726003) cysteine and histidine-rich domain (CHORD) containing 1
sheep(101108786) cysteine and histidine-rich domain (CHORD) containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100420 Anti-CHORDC1 antibody produced in rabbit affinity isolated antibody bovine, horse, rat, rabbit, mouse, canine, zebrafish, pig, human, guinea pig
western blot pricing
SAB3500253 Anti-CHORDC1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
HPA041040 Anti-CHORDC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012124 Rosetta Predictions human pricing
NM_001108128 Rosetta Predictions rat pricing
NM_025844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343671 predicted 940
2 SASI_Hs01_00024727 predicted 893
3 SASI_Hs01_00024728 predicted 952
4 SASI_Hs02_00343672 predicted 1075
5 SASI_Hs01_00024730 predicted 246
6 SASI_Hs01_00024731 predicted 970
7 SASI_Hs01_00024733 predicted 935
8 SASI_Hs01_00024734 predicted 587
9 SASI_Hs01_00024735 predicted 792
10 SASI_Hs02_00343673 predicted 326
11 SASI_Hs01_00024729 predicted 1023
12 SASI_Hs01_00024732 predicted 420
13 SASI_Hs01_00024736 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235634 predicted 907
2 SASI_Rn02_00235635 predicted 409
3 SASI_Rn02_00235636 predicted 1036
4 SASI_Rn02_00235637 predicted 653
5 SASI_Rn02_00235638 predicted 1166
6 SASI_Rn02_00235639 predicted 668
7 SASI_Rn02_00235640 predicted 1146
8 SASI_Rn02_00235641 predicted 483
9 SASI_Rn02_00235642 predicted 1025
10 SASI_Rn02_00235643 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168022 predicted 1017
2 SASI_Mm01_00168023 predicted 904
3 SASI_Mm01_00168024 predicted 389
4 SASI_Mm01_00168025 predicted 1000
5 SASI_Mm01_00168026 predicted 1116
6 SASI_Mm01_00168027 predicted 525
7 SASI_Mm01_00168028 predicted 886
8 SASI_Mm01_00168029 predicted 453
9 SASI_Mm01_00168030 predicted 634
10 SASI_Mm02_00329124 predicted 289
11 SASI_Mm01_00168021 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025844
CHORDC1 MISSION shRNA Bacterial Glycerol Stock
cysteine and histidine-rich domain (CHORD) containing 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025844.2-884s21c1
Sequence:CCGGCCAGAACTCAGTCAAGTAGAACTCGAGTTCTACTTGACTGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025844.2-1073s21c1
Sequence:CCGGCTTGAACTACCTACAACCAAACTCGAGTTTGGTTGTAGGTAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025844.2-1271s21c1
Sequence:CCGGCCTTTCGAGTTGCATAATATACTCGAGTATATTATGCAACTCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025844.2-1955s21c1
Sequence:CCGGGCGGCTTGAATCTGAAATGTACTCGAGTACATTTCAGATTCAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-1112s1c1
Sequence:CCGGGATATAGCTGATTGATTAGAACTCGAGTTCTAATCAATCAGCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-512s1c1
Sequence:CCGGCAAGCACTTGATAAACTTAAACTCGAGTTTAAGTTTATCAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-983s1c1
Sequence:CCGGGTAATTGATGTTAAACGAAGTCTCGAGACTTCGTTTAACATCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-563s1c1
Sequence:CCGGGAAGAAGACAGTGATGAAATTCTCGAGAATTTCATCACTGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.1-222s1c1
Sequence:CCGGCCTGTCTTTCATGATGCCCTACTCGAGTAGGGCATCATGAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.1-630s1c1
Sequence:CCGGCAGGGTCTACAGAGTCTAGAACTCGAGTTCTAGACTCTGTAGACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025844.1-885s1c1
Sequence:CCGGCCAGAACTCAGTCAAGTAGAACTCGAGTTCTACTTGACTGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025844.1-1956s1c1
Sequence:CCGGGCGGCTTGAATCTGAAATGTACTCGAGTACATTTCAGATTCAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025844.1-1074s1c1
Sequence:CCGGCTTGAACTACCTACAACCAAACTCGAGTTTGGTTGTAGGTAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025844.1-1272s1c1
Sequence:CCGGCCTTTCGAGTTGCATAATATACTCGAGTATATTATGCAACTCGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025844
CHORDC1 MISSION shRNA shRNA Plasmid DNA
cysteine and histidine-rich domain (CHORD) containing 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025844.2-884s21c1
Sequence:CCGGCCAGAACTCAGTCAAGTAGAACTCGAGTTCTACTTGACTGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025844.2-1073s21c1
Sequence:CCGGCTTGAACTACCTACAACCAAACTCGAGTTTGGTTGTAGGTAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025844.2-1271s21c1
Sequence:CCGGCCTTTCGAGTTGCATAATATACTCGAGTATATTATGCAACTCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025844.2-1955s21c1
Sequence:CCGGGCGGCTTGAATCTGAAATGTACTCGAGTACATTTCAGATTCAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-1112s1c1
Sequence:CCGGGATATAGCTGATTGATTAGAACTCGAGTTCTAATCAATCAGCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-512s1c1
Sequence:CCGGCAAGCACTTGATAAACTTAAACTCGAGTTTAAGTTTATCAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-983s1c1
Sequence:CCGGGTAATTGATGTTAAACGAAGTCTCGAGACTTCGTTTAACATCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-563s1c1
Sequence:CCGGGAAGAAGACAGTGATGAAATTCTCGAGAATTTCATCACTGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.1-222s1c1
Sequence:CCGGCCTGTCTTTCATGATGCCCTACTCGAGTAGGGCATCATGAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.1-630s1c1
Sequence:CCGGCAGGGTCTACAGAGTCTAGAACTCGAGTTCTAGACTCTGTAGACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025844.1-885s1c1
Sequence:CCGGCCAGAACTCAGTCAAGTAGAACTCGAGTTCTACTTGACTGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025844.1-1956s1c1
Sequence:CCGGGCGGCTTGAATCTGAAATGTACTCGAGTACATTTCAGATTCAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025844.1-1074s1c1
Sequence:CCGGCTTGAACTACCTACAACCAAACTCGAGTTTGGTTGTAGGTAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025844.1-1272s1c1
Sequence:CCGGCCTTTCGAGTTGCATAATATACTCGAGTATATTATGCAACTCGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025844
CHORDC1 MISSION shRNA Lentiviral Transduction Particles
cysteine and histidine-rich domain (CHORD) containing 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025844.2-884s21c1
Sequence:CCGGCCAGAACTCAGTCAAGTAGAACTCGAGTTCTACTTGACTGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025844.2-1073s21c1
Sequence:CCGGCTTGAACTACCTACAACCAAACTCGAGTTTGGTTGTAGGTAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025844.2-1271s21c1
Sequence:CCGGCCTTTCGAGTTGCATAATATACTCGAGTATATTATGCAACTCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025844.2-1955s21c1
Sequence:CCGGGCGGCTTGAATCTGAAATGTACTCGAGTACATTTCAGATTCAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-1112s1c1
Sequence:CCGGGATATAGCTGATTGATTAGAACTCGAGTTCTAATCAATCAGCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-512s1c1
Sequence:CCGGCAAGCACTTGATAAACTTAAACTCGAGTTTAAGTTTATCAAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-983s1c1
Sequence:CCGGGTAATTGATGTTAAACGAAGTCTCGAGACTTCGTTTAACATCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.2-563s1c1
Sequence:CCGGGAAGAAGACAGTGATGAAATTCTCGAGAATTTCATCACTGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.1-222s1c1
Sequence:CCGGCCTGTCTTTCATGATGCCCTACTCGAGTAGGGCATCATGAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025844.1-630s1c1
Sequence:CCGGCAGGGTCTACAGAGTCTAGAACTCGAGTTCTAGACTCTGTAGACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025844.1-885s1c1
Sequence:CCGGCCAGAACTCAGTCAAGTAGAACTCGAGTTCTACTTGACTGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025844.1-1956s1c1
Sequence:CCGGGCGGCTTGAATCTGAAATGTACTCGAGTACATTTCAGATTCAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025844.1-1074s1c1
Sequence:CCGGCTTGAACTACCTACAACCAAACTCGAGTTTGGTTGTAGGTAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025844.1-1272s1c1
Sequence:CCGGCCTTTCGAGTTGCATAATATACTCGAGTATATTATGCAACTCGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012124
VALIDATED
CHORDC1 MISSION shRNA Bacterial Glycerol Stock
cysteine and histidine-rich domain (CHORD) containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-596s21c1
Sequence:CCGGGTCTAGAAGAAGTCTGTGTATCTCGAGATACACAGACTTCTTCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-851s21c1
Sequence:CCGGGAGTAGAAGCAAATAGCACATCTCGAGATGTGCTATTTGCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-175s21c1
Sequence:CCGGCCGGTCTTTCACGATGCATTACTCGAGTAATGCATCGTGAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-1348s21c1
Sequence:CCGGCCCATAACCATAATTGCAGTACTCGAGTACTGCAATTATGGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-851s1c1
Sequence:CCGGGAGTAGAAGCAAATAGCACATCTCGAGATGTGCTATTTGCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-596s1c1
Sequence:CCGGGTCTAGAAGAAGTCTGTGTATCTCGAGATACACAGACTTCTTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-415s1c1
Sequence:CCGGCCAGATGAACCAATGACAAATCTCGAGATTTGTCATTGGTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-1348s1c1
Sequence:CCGGCCCATAACCATAATTGCAGTACTCGAGTACTGCAATTATGGTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-175s1c1
Sequence:CCGGCCGGTCTTTCACGATGCATTACTCGAGTAATGCATCGTGAAAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012124
VALIDATED
CHORDC1 MISSION shRNA shRNA Plasmid DNA
cysteine and histidine-rich domain (CHORD) containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-596s21c1
Sequence:CCGGGTCTAGAAGAAGTCTGTGTATCTCGAGATACACAGACTTCTTCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-851s21c1
Sequence:CCGGGAGTAGAAGCAAATAGCACATCTCGAGATGTGCTATTTGCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-175s21c1
Sequence:CCGGCCGGTCTTTCACGATGCATTACTCGAGTAATGCATCGTGAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-1348s21c1
Sequence:CCGGCCCATAACCATAATTGCAGTACTCGAGTACTGCAATTATGGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-851s1c1
Sequence:CCGGGAGTAGAAGCAAATAGCACATCTCGAGATGTGCTATTTGCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-596s1c1
Sequence:CCGGGTCTAGAAGAAGTCTGTGTATCTCGAGATACACAGACTTCTTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-415s1c1
Sequence:CCGGCCAGATGAACCAATGACAAATCTCGAGATTTGTCATTGGTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-1348s1c1
Sequence:CCGGCCCATAACCATAATTGCAGTACTCGAGTACTGCAATTATGGTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-175s1c1
Sequence:CCGGCCGGTCTTTCACGATGCATTACTCGAGTAATGCATCGTGAAAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012124
VALIDATED
CHORDC1 MISSION shRNA Lentiviral Transduction Particles
cysteine and histidine-rich domain (CHORD) containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-596s21c1
Sequence:CCGGGTCTAGAAGAAGTCTGTGTATCTCGAGATACACAGACTTCTTCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-851s21c1
Sequence:CCGGGAGTAGAAGCAAATAGCACATCTCGAGATGTGCTATTTGCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-175s21c1
Sequence:CCGGCCGGTCTTTCACGATGCATTACTCGAGTAATGCATCGTGAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012124.1-1348s21c1
Sequence:CCGGCCCATAACCATAATTGCAGTACTCGAGTACTGCAATTATGGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-851s1c1
Sequence:CCGGGAGTAGAAGCAAATAGCACATCTCGAGATGTGCTATTTGCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-596s1c1
Sequence:CCGGGTCTAGAAGAAGTCTGTGTATCTCGAGATACACAGACTTCTTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-415s1c1
Sequence:CCGGCCAGATGAACCAATGACAAATCTCGAGATTTGTCATTGGTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-1348s1c1
Sequence:CCGGCCCATAACCATAATTGCAGTACTCGAGTACTGCAATTATGGTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012124.1-175s1c1
Sequence:CCGGCCGGTCTTTCACGATGCATTACTCGAGTAATGCATCGTGAAAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks