EMAIL THIS PAGE TO A FRIEND

CHP1

calcineurin-like EF-hand protein 1

57 Gene Product Result for
Synonyms: CHP SLC9A1BP Sid470p p22 p24
UniProtKB ID: Q99653, B2R6H9, Q6FHZ9
Gene ID:
Human(11261) Summary: This gene encodes a phosphoprotein that binds to the Na+/H+ exchanger NHE1. This protein serves as an essential cofactor which supports the physiological activity of NHE family members and may play a role in the mitogenic regulation of NHE1. The protein shares similarity with calcineurin B and calmodulin and it is also known to be an endogenous inhibitor of calcineurin activity. [provided by RefSeq, Jul 2008]
Mouse(56398) calcineurin-like EF hand protein 1
Rat(64152) calcineurin-like EF-hand protein 1
Zebrafish(325361) calcineurin-like EF hand protein 1
cow(512662) calcium binding protein P22
domestic cat(101086483) calcineurin-like EF hand protein 1
dog(478264) calcineurin-like EF hand protein 1
chicken(423211) calcineurin-like EF hand protein 1
sheep(101112321) calcineurin-like EF hand protein 1
domestic guinea pig(100719349) calcineurin-like EF-hand protein 1
naked mole-rat(101724031) calcineurin-like EF-hand protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007236 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110131 MISSION® esiRNA esiRNA human AC012652.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007236 Rosetta Predictions human pricing
NM_024139 Rosetta Predictions rat pricing
NM_019769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343243 predicted 744
2 SASI_Hs02_00343244 predicted 566
3 SASI_Hs01_00036919 predicted 933
4 SASI_Hs01_00036921 predicted 537
5 SASI_Hs01_00036922 predicted 911
6 SASI_Hs01_00036925 predicted 383
7 SASI_Hs02_00343245 predicted 878
8 SASI_Hs02_00343246 predicted 538
9 SASI_Hs02_00343247 predicted 556
10 SASI_Hs02_00343248 predicted 909
11 SASI_Hs01_00036916 predicted 909
12 SASI_Hs01_00036917 predicted 860
13 SASI_Hs01_00036918 predicted 461
14 SASI_Hs01_00036920 predicted 371
15 SASI_Hs01_00036923 predicted 951
16 SASI_Hs01_00036924 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116047 predicted 551
2 SASI_Rn02_00263864 predicted 448
3 SASI_Rn02_00263865 predicted 484
4 SASI_Rn01_00116049 predicted 924
5 SASI_Rn01_00116050 predicted 913
6 SASI_Rn01_00116051 predicted 893
7 SASI_Rn01_00116053 predicted 278
8 SASI_Rn01_00116054 predicted 489
9 SASI_Rn01_00116055 predicted 357
10 SASI_Rn01_00116056 predicted 423
11 SASI_Rn01_00116048 predicted 373
12 SASI_Rn01_00116052 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324960 predicted 504
2 SASI_Mm02_00324961 predicted 556
3 SASI_Mm02_00324962 predicted 557
4 SASI_Mm02_00324963 predicted 636
5 SASI_Mm02_00324964 predicted 538
6 SASI_Mm02_00324965 predicted 542
7 SASI_Mm02_00324966 predicted 495
8 SASI_Mm02_00324967 predicted 566
9 SASI_Mm02_00324968 predicted 366
10 SASI_Mm02_00324969 predicted 372
11 SASI_Mm01_00035965 predicted 752
12 SASI_Mm01_00035966 predicted 157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019769
VALIDATED
CHP1 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like EF-hand protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019769.2-280s1c1
Sequence:CCGGCGGGAAGATTTCCAGAGGATTCTCGAGAATCCTCTGGAAATCTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019769.2-1782s1c1
Sequence:CCGGCCTGACTTATCTCAGTCCTAACTCGAGTTAGGACTGAGATAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019769.2-483s1c1
Sequence:CCGGGCACTTTGCTTTCAGACTCTACTCGAGTAGAGTCTGAAAGCAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-563s21c1
Sequence:CCGGGAATGATGGTTGGAGTGAATACTCGAGTATTCACTCCAACCATCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-412s21c1
Sequence:CCGGTTCCGACCCATTGAGGATAACCTCGAGGTTATCCTCAATGGGTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-360s21c1
Sequence:CCGGAGAGGGAGAGGATCAGGTAAACTCGAGTTTACCTGATCCTCTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019769.3-503s21c1
Sequence:CCGGGACTCTATGATTTGGATAAAGCTCGAGCTTTATCCAAATCATAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-2026s21c1
Sequence:CCGGACCAACTGAGGTGACATTTAGCTCGAGCTAAATGTCACCTCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019769
VALIDATED
CHP1 MISSION shRNA shRNA Plasmid DNA
calcineurin-like EF-hand protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019769.2-280s1c1
Sequence:CCGGCGGGAAGATTTCCAGAGGATTCTCGAGAATCCTCTGGAAATCTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019769.2-1782s1c1
Sequence:CCGGCCTGACTTATCTCAGTCCTAACTCGAGTTAGGACTGAGATAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019769.2-483s1c1
Sequence:CCGGGCACTTTGCTTTCAGACTCTACTCGAGTAGAGTCTGAAAGCAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-563s21c1
Sequence:CCGGGAATGATGGTTGGAGTGAATACTCGAGTATTCACTCCAACCATCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-412s21c1
Sequence:CCGGTTCCGACCCATTGAGGATAACCTCGAGGTTATCCTCAATGGGTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-360s21c1
Sequence:CCGGAGAGGGAGAGGATCAGGTAAACTCGAGTTTACCTGATCCTCTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019769.3-503s21c1
Sequence:CCGGGACTCTATGATTTGGATAAAGCTCGAGCTTTATCCAAATCATAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-2026s21c1
Sequence:CCGGACCAACTGAGGTGACATTTAGCTCGAGCTAAATGTCACCTCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019769
VALIDATED
CHP1 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like EF-hand protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019769.2-280s1c1
Sequence:CCGGCGGGAAGATTTCCAGAGGATTCTCGAGAATCCTCTGGAAATCTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019769.2-1782s1c1
Sequence:CCGGCCTGACTTATCTCAGTCCTAACTCGAGTTAGGACTGAGATAAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019769.2-483s1c1
Sequence:CCGGGCACTTTGCTTTCAGACTCTACTCGAGTAGAGTCTGAAAGCAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-563s21c1
Sequence:CCGGGAATGATGGTTGGAGTGAATACTCGAGTATTCACTCCAACCATCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-412s21c1
Sequence:CCGGTTCCGACCCATTGAGGATAACCTCGAGGTTATCCTCAATGGGTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-360s21c1
Sequence:CCGGAGAGGGAGAGGATCAGGTAAACTCGAGTTTACCTGATCCTCTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019769.3-503s21c1
Sequence:CCGGGACTCTATGATTTGGATAAAGCTCGAGCTTTATCCAAATCATAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019769.3-2026s21c1
Sequence:CCGGACCAACTGAGGTGACATTTAGCTCGAGCTAAATGTCACCTCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007236
VALIDATED
CHP1 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like EF-hand protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-562s1c1
Sequence:CCGGCGCATGATGGTCGGAGTAAATCTCGAGATTTACTCCGACCATCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-652s1c1
Sequence:CCGGGCCATATCTTTCACAGAATTTCTCGAGAAATTCTGTGAAAGATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-372s1c1
Sequence:CCGGCCAGGTAAACTTCCGTGGATTCTCGAGAATCCACGGAAGTTTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-219s1c1
Sequence:CCGGCAGTCAAATCACTCGCCTCTACTCGAGTAGAGGCGAGTGATTTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-276s21c1
Sequence:CCGGGACTCTCAGCCGGGAAGATTTCTCGAGAAATCTTCCCGGCTGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-561s21c1
Sequence:CCGGACGCATGATGGTCGGAGTAAACTCGAGTTTACTCCGACCATCATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-713s21c1
Sequence:CCGGGCATCCGATTTCTTCACTAAACTCGAGTTTAGTGAAGAAATCGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-385s21c1
Sequence:CCGGCGTGGATTCATGCGAACTTTGCTCGAGCAAAGTTCGCATGAATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-1817s21c1
Sequence:CCGGTGTTACGGAAGTGCCTAATATCTCGAGATATTAGGCACTTCCGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007236
VALIDATED
CHP1 MISSION shRNA shRNA Plasmid DNA
calcineurin-like EF-hand protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-562s1c1
Sequence:CCGGCGCATGATGGTCGGAGTAAATCTCGAGATTTACTCCGACCATCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-652s1c1
Sequence:CCGGGCCATATCTTTCACAGAATTTCTCGAGAAATTCTGTGAAAGATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-372s1c1
Sequence:CCGGCCAGGTAAACTTCCGTGGATTCTCGAGAATCCACGGAAGTTTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-219s1c1
Sequence:CCGGCAGTCAAATCACTCGCCTCTACTCGAGTAGAGGCGAGTGATTTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-276s21c1
Sequence:CCGGGACTCTCAGCCGGGAAGATTTCTCGAGAAATCTTCCCGGCTGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-561s21c1
Sequence:CCGGACGCATGATGGTCGGAGTAAACTCGAGTTTACTCCGACCATCATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-713s21c1
Sequence:CCGGGCATCCGATTTCTTCACTAAACTCGAGTTTAGTGAAGAAATCGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-385s21c1
Sequence:CCGGCGTGGATTCATGCGAACTTTGCTCGAGCAAAGTTCGCATGAATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-1817s21c1
Sequence:CCGGTGTTACGGAAGTGCCTAATATCTCGAGATATTAGGCACTTCCGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007236
VALIDATED
CHP1 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like EF-hand protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-562s1c1
Sequence:CCGGCGCATGATGGTCGGAGTAAATCTCGAGATTTACTCCGACCATCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-652s1c1
Sequence:CCGGGCCATATCTTTCACAGAATTTCTCGAGAAATTCTGTGAAAGATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-372s1c1
Sequence:CCGGCCAGGTAAACTTCCGTGGATTCTCGAGAATCCACGGAAGTTTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007236.3-219s1c1
Sequence:CCGGCAGTCAAATCACTCGCCTCTACTCGAGTAGAGGCGAGTGATTTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-276s21c1
Sequence:CCGGGACTCTCAGCCGGGAAGATTTCTCGAGAAATCTTCCCGGCTGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-561s21c1
Sequence:CCGGACGCATGATGGTCGGAGTAAACTCGAGTTTACTCCGACCATCATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-713s21c1
Sequence:CCGGGCATCCGATTTCTTCACTAAACTCGAGTTTAGTGAAGAAATCGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-385s21c1
Sequence:CCGGCGTGGATTCATGCGAACTTTGCTCGAGCAAAGTTCGCATGAATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007236.4-1817s21c1
Sequence:CCGGTGTTACGGAAGTGCCTAATATCTCGAGATATTAGGCACTTCCGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)