EMAIL THIS PAGE TO A FRIEND

CHP2

calcineurin-like EF-hand protein 2

55 Gene Product Result for
UniProtKB ID: O43745
Gene ID:
Human(63928) Summary: This gene product is a small calcium-binding protein that regulates cell pH by controlling plasma membrane-type Na+/H+ exchange activity. This protein shares sequence similarity with calcineurin B and can bind to and stimulate the protein phosphatase activity of calcineurin A (CnA) and functions in the calcineurin/NFAT (nuclear factor of activated T cells) signaling pathway. Another member of the CHP subfamily, Calcineurin B homologous protein 1, is located on Chromosome 15 and is an inhibitor of calcineurin activity and has a genetic phenotype associated with Parkinson's Disease (OMIM:606988). This gene was initially identified as a tumor-associated antigen and was previously referred to as Hepatocellular carcinoma-associated antigen 520. [provided by RefSeq, Jul 2013]
Mouse(70261) calcineurin-like EF hand protein 2
Rat(308965) calcineurin-like EF hand protein 2
naked mole-rat(101722351) calcineurin-like EF-hand protein 2
domestic guinea pig(100722300) calcineurin-like EF-hand protein 2
sheep(101118159) calcineurin-like EF hand protein 2
Zebrafish(327599) calcineurin-like EF hand protein 2
domestic cat(101089230) calcineurin-like EF hand protein 2
cow(515280) calcineurin B homologous protein 2
dog(489969) calcineurin B homologous protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502725 Anti-CHP2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300914 Anti-CHP2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022097 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_027363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161551 MISSION® esiRNA esiRNA targeting mouse 2010110P09Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022097 Rosetta Predictions human pricing
NM_182738 Rosetta Predictions rat pricing
NM_027363 Rosetta Predictions mouse pricing
XM_355937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072381 predicted 769
2 SASI_Hs01_00072382 predicted 752
3 SASI_Hs01_00072384 predicted 556
4 SASI_Hs01_00072385 predicted 655
5 SASI_Hs01_00072387 predicted 548
6 SASI_Hs02_00355485 predicted 456
7 SASI_Hs01_00072388 predicted 523
8 SASI_Hs01_00072389 predicted 816
9 SASI_Hs02_00355486 predicted 477
10 SASI_Hs02_00355487 predicted 768
11 SASI_Hs01_00072380 predicted 837
12 SASI_Hs01_00072383 predicted 654
13 SASI_Hs01_00072386 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049706 predicted 929
2 SASI_Rn01_00049707 predicted 261
3 SASI_Rn01_00049708 predicted 712
4 SASI_Rn01_00049709 predicted 792
5 SASI_Rn01_00049710 predicted 813
6 SASI_Rn01_00049711 predicted 654
7 SASI_Rn01_00049713 predicted 774
8 SASI_Rn01_00049714 predicted 875
9 SASI_Rn01_00049715 predicted 384
10 SASI_Rn02_00269836 predicted 716
11 SASI_Rn01_00049712 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332034 predicted 666
2 SASI_Mm02_00332035 predicted 557
3 SASI_Mm02_00332036 predicted 444
4 SASI_Mm02_00332037 predicted 594
5 SASI_Mm02_00332038 predicted 681
6 SASI_Mm02_00332039 predicted 588
7 SASI_Mm02_00332040 predicted 406
8 SASI_Mm02_00332041 predicted 605
9 SASI_Mm02_00332042 predicted 382
10 SASI_Mm02_00332043 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226037 predicted 569
2 SASI_Mm01_00226038 predicted 457
3 SASI_Mm01_00226039 predicted 1139
4 SASI_Mm01_00226040 predicted 1233
5 SASI_Mm01_00226041 predicted 621
6 SASI_Mm01_00226042 predicted 1315
7 SASI_Mm01_00226043 predicted 1002
8 SASI_Mm01_00226044 predicted 982
9 SASI_Mm01_00226045 predicted 421
10 SASI_Mm01_00226046 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022097
CHP2 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like EF-hand protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022097.2-1087s21c1
Sequence:CCGGATGGACGCAGGGCGACAATAACTCGAGTTATTGTCGCCCTGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022097.2-672s21c1
Sequence:CCGGTGTCAGGGTCTTGGCTCATTTCTCGAGAAATGAGCCAAGACCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022097.2-605s21c1
Sequence:CCGGCCCTGGGAGACCGAATTATAGCTCGAGCTATAATTCGGTCTCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022097.2-1376s21c1
Sequence:CCGGTGCAATTAGACGGTCCCATATCTCGAGATATGGGACCGTCTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-570s1c1
Sequence:CCGGCGCATGGATCTCCAGCAGATACTCGAGTATCTGCTGGAGATCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-972s1c1
Sequence:CCGGGAGAAGATGGACGTTGAGCAACTCGAGTTGCTCAACGTCCATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-668s1c1
Sequence:CCGGCCCAGGCTTTGTCAGGGTCTTCTCGAGAAGACCCTGACAAAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-951s1c1
Sequence:CCGGGTGGAGTTCACCAAGTCCTTACTCGAGTAAGGACTTGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022097
CHP2 MISSION shRNA shRNA Plasmid DNA
calcineurin-like EF-hand protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022097.2-1087s21c1
Sequence:CCGGATGGACGCAGGGCGACAATAACTCGAGTTATTGTCGCCCTGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022097.2-672s21c1
Sequence:CCGGTGTCAGGGTCTTGGCTCATTTCTCGAGAAATGAGCCAAGACCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022097.2-605s21c1
Sequence:CCGGCCCTGGGAGACCGAATTATAGCTCGAGCTATAATTCGGTCTCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022097.2-1376s21c1
Sequence:CCGGTGCAATTAGACGGTCCCATATCTCGAGATATGGGACCGTCTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-570s1c1
Sequence:CCGGCGCATGGATCTCCAGCAGATACTCGAGTATCTGCTGGAGATCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-972s1c1
Sequence:CCGGGAGAAGATGGACGTTGAGCAACTCGAGTTGCTCAACGTCCATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-668s1c1
Sequence:CCGGCCCAGGCTTTGTCAGGGTCTTCTCGAGAAGACCCTGACAAAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-951s1c1
Sequence:CCGGGTGGAGTTCACCAAGTCCTTACTCGAGTAAGGACTTGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022097
CHP2 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like EF-hand protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022097.2-1087s21c1
Sequence:CCGGATGGACGCAGGGCGACAATAACTCGAGTTATTGTCGCCCTGCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022097.2-672s21c1
Sequence:CCGGTGTCAGGGTCTTGGCTCATTTCTCGAGAAATGAGCCAAGACCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022097.2-605s21c1
Sequence:CCGGCCCTGGGAGACCGAATTATAGCTCGAGCTATAATTCGGTCTCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022097.2-1376s21c1
Sequence:CCGGTGCAATTAGACGGTCCCATATCTCGAGATATGGGACCGTCTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-570s1c1
Sequence:CCGGCGCATGGATCTCCAGCAGATACTCGAGTATCTGCTGGAGATCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-972s1c1
Sequence:CCGGGAGAAGATGGACGTTGAGCAACTCGAGTTGCTCAACGTCCATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-668s1c1
Sequence:CCGGCCCAGGCTTTGTCAGGGTCTTCTCGAGAAGACCCTGACAAAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022097.1-951s1c1
Sequence:CCGGGTGGAGTTCACCAAGTCCTTACTCGAGTAAGGACTTGGTGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355937
CHP2 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like EF-hand protein 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-580s1c1
Sequence:CCGGGCGCTTTGCATTTCAGCTCTACTCGAGTAGAGCTGAAATGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-760s1c1
Sequence:CCGGGTTCACCAAGTCCTTAGAGAACTCGAGTTCTCTAAGGACTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-424s1c1
Sequence:CCGGCCGCATTATAGACAGCTTCTTCTCGAGAAGAAGCTGTCTATAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-556s1c1
Sequence:CCGGCCTAAACAGCAGAATGAACAACTCGAGTTGTTCATTCTGCTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-614s1c1
Sequence:CCGGGATGGGAAGATCTCCAGGAATCTCGAGATTCCTGGAGATCTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_355937.1-1189s1c1
Sequence:CCGGCCTCCTTGCATTGGGATCATTCTCGAGAATGATCCCAATGCAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355937
CHP2 MISSION shRNA shRNA Plasmid DNA
calcineurin-like EF-hand protein 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-580s1c1
Sequence:CCGGGCGCTTTGCATTTCAGCTCTACTCGAGTAGAGCTGAAATGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-760s1c1
Sequence:CCGGGTTCACCAAGTCCTTAGAGAACTCGAGTTCTCTAAGGACTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-424s1c1
Sequence:CCGGCCGCATTATAGACAGCTTCTTCTCGAGAAGAAGCTGTCTATAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-556s1c1
Sequence:CCGGCCTAAACAGCAGAATGAACAACTCGAGTTGTTCATTCTGCTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-614s1c1
Sequence:CCGGGATGGGAAGATCTCCAGGAATCTCGAGATTCCTGGAGATCTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_355937.1-1189s1c1
Sequence:CCGGCCTCCTTGCATTGGGATCATTCTCGAGAATGATCCCAATGCAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355937
CHP2 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like EF-hand protein 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-580s1c1
Sequence:CCGGGCGCTTTGCATTTCAGCTCTACTCGAGTAGAGCTGAAATGCAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-760s1c1
Sequence:CCGGGTTCACCAAGTCCTTAGAGAACTCGAGTTCTCTAAGGACTTGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-424s1c1
Sequence:CCGGCCGCATTATAGACAGCTTCTTCTCGAGAAGAAGCTGTCTATAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-556s1c1
Sequence:CCGGCCTAAACAGCAGAATGAACAACTCGAGTTGTTCATTCTGCTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_355937.1-614s1c1
Sequence:CCGGGATGGGAAGATCTCCAGGAATCTCGAGATTCCTGGAGATCTTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_355937.1-1189s1c1
Sequence:CCGGCCTCCTTGCATTGGGATCATTCTCGAGAATGATCCCAATGCAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027363
CHP2 MISSION shRNA Bacterial Glycerol Stock
calcineurin-like EF-hand protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027363.1-830s21c2
Sequence:CCGGACGTCTGTGGGCTTGGGATTTCTCGAGAAATCCCAAGCCCACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-603s21c1
Sequence:CCGGGAAGATCTCCAGGAATGAAATCTCGAGATTTCATTCCTGGAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-248s21c1
Sequence:CCGGTTCCAGACGTGGAGCACATTCCTCGAGGAATGTGCTCCACGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-434s21c1
Sequence:CCGGACGGAAGTCAGAGACTGTATTCTCGAGAATACAGTCTCTGACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-397s21c1
Sequence:CCGGCCACTGGGTGACCGCATTATACTCGAGTATAATGCGGTCACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027363
CHP2 MISSION shRNA shRNA Plasmid DNA
calcineurin-like EF-hand protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027363.1-830s21c2
Sequence:CCGGACGTCTGTGGGCTTGGGATTTCTCGAGAAATCCCAAGCCCACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-603s21c1
Sequence:CCGGGAAGATCTCCAGGAATGAAATCTCGAGATTTCATTCCTGGAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-248s21c1
Sequence:CCGGTTCCAGACGTGGAGCACATTCCTCGAGGAATGTGCTCCACGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-434s21c1
Sequence:CCGGACGGAAGTCAGAGACTGTATTCTCGAGAATACAGTCTCTGACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-397s21c1
Sequence:CCGGCCACTGGGTGACCGCATTATACTCGAGTATAATGCGGTCACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027363
CHP2 MISSION shRNA Lentiviral Transduction Particles
calcineurin-like EF-hand protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027363.1-830s21c2
Sequence:CCGGACGTCTGTGGGCTTGGGATTTCTCGAGAAATCCCAAGCCCACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-603s21c1
Sequence:CCGGGAAGATCTCCAGGAATGAAATCTCGAGATTTCATTCCTGGAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-248s21c1
Sequence:CCGGTTCCAGACGTGGAGCACATTCCTCGAGGAATGTGCTCCACGTCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-434s21c1
Sequence:CCGGACGGAAGTCAGAGACTGTATTCTCGAGAATACAGTCTCTGACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027363.1-397s21c1
Sequence:CCGGCCACTGGGTGACCGCATTATACTCGAGTATAATGCGGTCACCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks