EMAIL THIS PAGE TO A FRIEND

CHPF2

chondroitin polymerizing factor 2

49 Gene Product Result for
Synonyms: CSGLCA-T CSGlcAT ChSy-3
UniProtKB ID: Q9P2E5, B2DBD8, Q6P2I4, Q6UXD2
Gene ID:
Mouse(100910) chondroitin polymerizing factor 2
Rat(296733) chondroitin polymerizing factor 2
naked mole-rat(101703677) chondroitin polymerizing factor 2
domestic guinea pig(100725298) chondroitin polymerizing factor 2
sheep(101114606) chondroitin polymerizing factor 2
Domestic Rabbit(100344738) chondroitin polymerizing factor 2
Zebrafish(100000654) chondroitin polymerizing factor 2
domestic cat(101099111) chondroitin polymerizing factor 2
cow(100616099) chondroitin polymerizing factor 2
Horse(100063539) chondroitin polymerizing factor 2
chicken(426039) chondroitin polymerizing factor 2
dog(482807) chondroitin polymerizing factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019015 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019015 Rosetta Predictions human pricing
NM_001106574 Rosetta Predictions rat pricing
NM_133913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015046 predicted 2495
2 SASI_Hs02_00352543 predicted 3702
3 SASI_Hs01_00015047 predicted 1685
4 SASI_Hs01_00015048 predicted 1937
5 SASI_Hs01_00015050 predicted 2937
6 SASI_Hs01_00015051 predicted 2397
7 SASI_Hs02_00352544 predicted 2922
8 SASI_Hs01_00015052 predicted 2028
9 SASI_Hs01_00015053 predicted 2478
10 SASI_Hs01_00015054 predicted 2050
11 SASI_Hs01_00015049 predicted 2680
12 SASI_Hs01_00015055 predicted 3157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220298 predicted 1510
2 SASI_Rn02_00220299 predicted 3101
3 SASI_Rn02_00220300 predicted 1838
4 SASI_Rn02_00220301 predicted 3336
5 SASI_Rn02_00220302 predicted 1910
6 SASI_Rn02_00220303 predicted 1695
7 SASI_Rn02_00220304 predicted 2306
8 SASI_Rn02_00220305 predicted 1558
9 SASI_Rn02_00220306 predicted 2885
10 SASI_Rn02_00220307 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338972 predicted 2218
2 SASI_Mm02_00338973 predicted 1912
3 SASI_Mm02_00338974 predicted 1798
4 SASI_Mm02_00338975 predicted 3067
5 SASI_Mm02_00338976 predicted 1506
6 SASI_Mm02_00338977 predicted 1520
7 SASI_Mm02_00338978 predicted 1799
8 SASI_Mm02_00338979 predicted 1655
9 SASI_Mm02_00338980 predicted 3284
10 SASI_Mm02_00338981 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019015
CHPF2 MISSION shRNA Bacterial Glycerol Stock
chondroitin polymerizing factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-1841s21c1
Sequence:CCGGCGAGCTACACTGTCCACTTTGCTCGAGCAAAGTGGACAGTGTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-2451s21c1
Sequence:CCGGTCATGTACCGGCTCCACAAACCTCGAGGTTTGTGGAGCCGGTACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-1663s21c1
Sequence:CCGGAGGGCCACAGAATCCAGATTCCTCGAGGAATCTGGATTCTGTGGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-3324s21c1
Sequence:CCGGTCAACCGCTGTCGCATGAATGCTCGAGCATTCATGCGACAGCGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2354s1c1
Sequence:CCGGCGCTCATTTGAACTGGCCAAACTCGAGTTTGGCCAGTTCAAATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-1691s1c1
Sequence:CCGGCGGCTAGACCAAAGTGATGAACTCGAGTTCATCACTTTGGTCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2495s1c1
Sequence:CCGGCGGGCTTACAGTGAAATAGAACTCGAGTTCTATTTCACTGTAAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2932s1c1
Sequence:CCGGCCGGGTGGAAATCCTACCTATCTCGAGATAGGTAGGATTTCCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019015
CHPF2 MISSION shRNA shRNA Plasmid DNA
chondroitin polymerizing factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-1841s21c1
Sequence:CCGGCGAGCTACACTGTCCACTTTGCTCGAGCAAAGTGGACAGTGTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-2451s21c1
Sequence:CCGGTCATGTACCGGCTCCACAAACCTCGAGGTTTGTGGAGCCGGTACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-1663s21c1
Sequence:CCGGAGGGCCACAGAATCCAGATTCCTCGAGGAATCTGGATTCTGTGGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-3324s21c1
Sequence:CCGGTCAACCGCTGTCGCATGAATGCTCGAGCATTCATGCGACAGCGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2354s1c1
Sequence:CCGGCGCTCATTTGAACTGGCCAAACTCGAGTTTGGCCAGTTCAAATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-1691s1c1
Sequence:CCGGCGGCTAGACCAAAGTGATGAACTCGAGTTCATCACTTTGGTCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2495s1c1
Sequence:CCGGCGGGCTTACAGTGAAATAGAACTCGAGTTCTATTTCACTGTAAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2932s1c1
Sequence:CCGGCCGGGTGGAAATCCTACCTATCTCGAGATAGGTAGGATTTCCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019015
CHPF2 MISSION shRNA Lentiviral Transduction Particles
chondroitin polymerizing factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-1841s21c1
Sequence:CCGGCGAGCTACACTGTCCACTTTGCTCGAGCAAAGTGGACAGTGTAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-2451s21c1
Sequence:CCGGTCATGTACCGGCTCCACAAACCTCGAGGTTTGTGGAGCCGGTACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-1663s21c1
Sequence:CCGGAGGGCCACAGAATCCAGATTCCTCGAGGAATCTGGATTCTGTGGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019015.1-3324s21c1
Sequence:CCGGTCAACCGCTGTCGCATGAATGCTCGAGCATTCATGCGACAGCGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2354s1c1
Sequence:CCGGCGCTCATTTGAACTGGCCAAACTCGAGTTTGGCCAGTTCAAATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-1691s1c1
Sequence:CCGGCGGCTAGACCAAAGTGATGAACTCGAGTTCATCACTTTGGTCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2495s1c1
Sequence:CCGGCGGGCTTACAGTGAAATAGAACTCGAGTTCTATTTCACTGTAAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019015.1-2932s1c1
Sequence:CCGGCCGGGTGGAAATCCTACCTATCTCGAGATAGGTAGGATTTCCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks