EMAIL THIS PAGE TO A FRIEND

CHPF

chondroitin polymerizing factor

62 Gene Product Result for
Synonyms: CHSY2 CSS2
UniProtKB ID: Q8IZ52, Q6UXD6, Q7L4G1, Q9H0F8, Q9H618
Gene ID:
Mouse(74241) chondroitin polymerizing factor
Rat(316533) chondroitin polymerizing factor
chicken(769112) chondroitin polymerizing factor
cow(540002) chondroitin polymerizing factor
domestic cat(101097752) chondroitin polymerizing factor
dog(488538) chondroitin polymerizing factor
sheep(101114088) chondroitin polymerizing factor
Domestic Rabbit(100328892) chondroitin polymerizing factor
domestic guinea pig(100721681) chondroitin polymerizing factor
naked mole-rat(101707555) chondroitin polymerizing factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024536 Rosetta Predictions human pricing
NM_001005906 Rosetta Predictions rat pricing
NM_001001565 Rosetta Predictions mouse pricing
NM_001001566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012524 predicted 1706
2 SASI_Hs01_00012526 predicted 2131
3 SASI_Hs01_00012528 predicted 1900
4 SASI_Hs01_00012529 predicted 1344
5 SASI_Hs01_00012530 predicted 1900
6 SASI_Hs01_00012531 predicted 1569
7 SASI_Hs01_00012532 predicted 2218
8 SASI_Hs01_00012533 predicted 1904
9 SASI_Hs02_00356828 predicted 1477
10 SASI_Hs01_00012525 predicted 2513
11 SASI_Hs01_00012527 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198492 predicted 1674
2 SASI_Rn01_00062786 predicted 2485
3 SASI_Rn01_00062787 predicted 1228
4 SASI_Rn01_00062788 predicted 1863
5 SASI_Rn01_00062789 predicted 1228
6 SASI_Rn02_00198493 predicted 624
7 SASI_Rn01_00062790 predicted 1533
8 SASI_Rn01_00062792 predicted 1138
9 SASI_Rn01_00062793 predicted 2189
10 SASI_Rn01_00062794 predicted 1566
11 SASI_Rn01_00062785 predicted 1874
12 SASI_Rn01_00062791 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104891 predicted 896
2 SASI_Mm02_00286185 predicted 1222
3 SASI_Mm01_00104892 predicted 2452
4 SASI_Mm01_00104893 predicted 1900
5 SASI_Mm01_00104895 predicted 943
6 SASI_Mm01_00104896 predicted 2823
7 SASI_Mm01_00104897 predicted 958
8 SASI_Mm01_00104898 predicted 1382
9 SASI_Mm01_00104899 predicted 2190
10 SASI_Mm01_00104900 predicted 1946
11 SASI_Mm01_00104894 predicted 2553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119277 predicted 844
2 SASI_Mm02_00286186 predicted 1179
3 SASI_Mm01_00119278 predicted 2402
4 SASI_Mm01_00119279 predicted 1843
5 SASI_Mm01_00119281 predicted 891
6 SASI_Mm01_00119282 predicted 2776
7 SASI_Mm01_00119283 predicted 913
8 SASI_Mm01_00119284 predicted 1334
9 SASI_Mm01_00119285 predicted 2137
10 SASI_Mm01_00119286 predicted 1888
11 SASI_Mm01_00119280 predicted 2503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024536
CHPF MISSION shRNA Bacterial Glycerol Stock
chondroitin polymerizing factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-1966s1c1
Sequence:CCGGCCTCATGGATCTACTCTCCAACTCGAGTTGGAGAGTAGATCCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-2470s1c1
Sequence:CCGGGCTACTCTTTGAACAGGAGCACTCGAGTGCTCCTGTTCAAAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-1969s1c1
Sequence:CCGGCATGGATCTACTCTCCAAGAACTCGAGTTCTTGGAGAGTAGATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-2509s21c1
Sequence:CCGGAGCTGGCCATGCTACTCTTTGCTCGAGCAAAGAGTAGCATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024536.5-2801s21c1
Sequence:CCGGGCTGTGGCCTCCACGTATTTACTCGAGTAAATACGTGGAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1712s21c1
Sequence:CCGGGATCTTGCCTGTGCCCTATGTCTCGAGACATAGGGCACAGGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1291s21c1
Sequence:CCGGTACAGTGGGAGATCCAGAATACTCGAGTATTCTGGATCTCCCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1573s21c1
Sequence:CCGGTGAATGGCTACCGACGCTTTGCTCGAGCAAAGCGTCGGTAGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024536
CHPF MISSION shRNA shRNA Plasmid DNA
chondroitin polymerizing factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-1966s1c1
Sequence:CCGGCCTCATGGATCTACTCTCCAACTCGAGTTGGAGAGTAGATCCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-2470s1c1
Sequence:CCGGGCTACTCTTTGAACAGGAGCACTCGAGTGCTCCTGTTCAAAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-1969s1c1
Sequence:CCGGCATGGATCTACTCTCCAAGAACTCGAGTTCTTGGAGAGTAGATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-2509s21c1
Sequence:CCGGAGCTGGCCATGCTACTCTTTGCTCGAGCAAAGAGTAGCATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024536.5-2801s21c1
Sequence:CCGGGCTGTGGCCTCCACGTATTTACTCGAGTAAATACGTGGAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1712s21c1
Sequence:CCGGGATCTTGCCTGTGCCCTATGTCTCGAGACATAGGGCACAGGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1291s21c1
Sequence:CCGGTACAGTGGGAGATCCAGAATACTCGAGTATTCTGGATCTCCCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1573s21c1
Sequence:CCGGTGAATGGCTACCGACGCTTTGCTCGAGCAAAGCGTCGGTAGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024536
CHPF MISSION shRNA Lentiviral Transduction Particles
chondroitin polymerizing factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-1966s1c1
Sequence:CCGGCCTCATGGATCTACTCTCCAACTCGAGTTGGAGAGTAGATCCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-2470s1c1
Sequence:CCGGGCTACTCTTTGAACAGGAGCACTCGAGTGCTCCTGTTCAAAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024536.4-1969s1c1
Sequence:CCGGCATGGATCTACTCTCCAAGAACTCGAGTTCTTGGAGAGTAGATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-2509s21c1
Sequence:CCGGAGCTGGCCATGCTACTCTTTGCTCGAGCAAAGAGTAGCATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024536.5-2801s21c1
Sequence:CCGGGCTGTGGCCTCCACGTATTTACTCGAGTAAATACGTGGAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1712s21c1
Sequence:CCGGGATCTTGCCTGTGCCCTATGTCTCGAGACATAGGGCACAGGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1291s21c1
Sequence:CCGGTACAGTGGGAGATCCAGAATACTCGAGTATTCTGGATCTCCCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024536.5-1573s21c1
Sequence:CCGGTGAATGGCTACCGACGCTTTGCTCGAGCAAAGCGTCGGTAGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001565
VALIDATED
CHPF MISSION shRNA Bacterial Glycerol Stock
chondroitin polymerizing factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2770s1c1
Sequence:CCGGTGGTCCCTTGTCTCTTGCTTTCTCGAGAAAGCAAGAGACAAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-1230s1c1
Sequence:CCGGCGAGGGAATGCACTACAACTACTCGAGTAGTTGTAGTGCATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001565.1-1000s1c1
Sequence:CCGGGCTTCAGCAACCCATCTCTATCTCGAGATAGAGATGGGTTGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2374s1c1
Sequence:CCGGTGCTTCTACAACTCCGACTATCTCGAGATAGTCGGAGTTGTAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2454s1c1
Sequence:CCGGCCTGGATGTGTACGAGTTGTTCTCGAGAACAACTCGTACACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001565
VALIDATED
CHPF MISSION shRNA shRNA Plasmid DNA
chondroitin polymerizing factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2770s1c1
Sequence:CCGGTGGTCCCTTGTCTCTTGCTTTCTCGAGAAAGCAAGAGACAAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-1230s1c1
Sequence:CCGGCGAGGGAATGCACTACAACTACTCGAGTAGTTGTAGTGCATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001565.1-1000s1c1
Sequence:CCGGGCTTCAGCAACCCATCTCTATCTCGAGATAGAGATGGGTTGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2374s1c1
Sequence:CCGGTGCTTCTACAACTCCGACTATCTCGAGATAGTCGGAGTTGTAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2454s1c1
Sequence:CCGGCCTGGATGTGTACGAGTTGTTCTCGAGAACAACTCGTACACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001565
VALIDATED
CHPF MISSION shRNA Lentiviral Transduction Particles
chondroitin polymerizing factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2770s1c1
Sequence:CCGGTGGTCCCTTGTCTCTTGCTTTCTCGAGAAAGCAAGAGACAAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-1230s1c1
Sequence:CCGGCGAGGGAATGCACTACAACTACTCGAGTAGTTGTAGTGCATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001565.1-1000s1c1
Sequence:CCGGGCTTCAGCAACCCATCTCTATCTCGAGATAGAGATGGGTTGCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2374s1c1
Sequence:CCGGTGCTTCTACAACTCCGACTATCTCGAGATAGTCGGAGTTGTAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001001565.1-2454s1c1
Sequence:CCGGCCTGGATGTGTACGAGTTGTTCTCGAGAACAACTCGTACACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks