EMAIL THIS PAGE TO A FRIEND

CHPT1

choline phosphotransferase 1

Synonyms: CPT CPT1
Gene ID:
Mouse(212862) choline phosphotransferase 1
Rat(362866) choline phosphotransferase 1
Zebrafish(322605) choline phosphotransferase 1
cow(511291) choline phosphotransferase 1
domestic cat(101099986) choline phosphotransferase 1
dog(610214) choline phosphotransferase 1
chicken(418098) choline phosphotransferase 1
sheep(101108821) choline phosphotransferase 1
domestic guinea pig(100718704) choline phosphotransferase 1
naked mole-rat(101711138) choline phosphotransferase 1
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020244 Rosetta Predictions human pricing
NM_001007750 Rosetta Predictions rat pricing
XM_001079984 Rosetta Predictions rat pricing
NM_144807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072084 predicted 910
2 SASI_Hs01_00072085 predicted 1152
3 SASI_Hs01_00072086 predicted 1051
4 SASI_Hs01_00072087 predicted 1017
5 SASI_Hs01_00072088 predicted 1034
6 SASI_Hs01_00072089 predicted 1020
7 SASI_Hs01_00072090 predicted 1263
8 SASI_Hs01_00072091 predicted 305
9 SASI_Hs01_00072092 predicted 1301
10 SASI_Hs02_00353199 predicted 1276
11 SASI_Hs01_00072083 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076842 predicted 1142
2 SASI_Rn01_00076843 predicted 1162
3 SASI_Rn01_00076844 predicted 668
4 SASI_Rn01_00076845 predicted 981
5 SASI_Rn01_00076846 predicted 1029
6 SASI_Rn01_00076847 predicted 1174
7 SASI_Rn01_00076848 predicted 742
8 SASI_Rn01_00076849 predicted 927
9 SASI_Rn01_00076850 predicted 1104
10 SASI_Rn01_00076851 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366174 predicted 1135
2 SASI_Rn02_00366175 predicted 1152
3 SASI_Rn02_00366176 predicted 664
4 SASI_Rn02_00366177 predicted 974
5 SASI_Rn02_00366178 predicted 1019
6 SASI_Rn02_00366179 predicted 1169
7 SASI_Rn02_00366180 predicted 727
8 SASI_Rn02_00366181 predicted 1096
9 SASI_Rn02_00366182 predicted 203
10 SASI_Rn02_00366183 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027214 predicted 580
2 SASI_Mm02_00340163 predicted 698
3 SASI_Mm01_00027215 predicted 236
4 SASI_Mm02_00340164 predicted 1063
5 SASI_Mm01_00027218 predicted 649
6 SASI_Mm01_00027219 predicted 1018
7 SASI_Mm02_00340165 predicted 1274
8 SASI_Mm01_00027220 predicted 1080
9 SASI_Mm01_00027221 predicted 489
10 SASI_Mm01_00027222 predicted 724
11 SASI_Mm01_00027213 predicted 1139
12 SASI_Mm01_00027216 predicted 1288
13 SASI_Mm01_00027217 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020244
VALIDATED
CHPT1 MISSION shRNA Bacterial Glycerol Stock
choline phosphotransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-1335s1c1
Sequence:CCGGGCACCTGAACAGGTTCAAGTTCTCGAGAACTTGAACCTGTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-698s1c1
Sequence:CCGGGCAGACTTATGTTTCAGGCATCTCGAGATGCCTGAAACATAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-806s1c1
Sequence:CCGGGTGGGACTATACGATTCCTATCTCGAGATAGGAATCGTATAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-858s1c1
Sequence:CCGGCTTGGATTTCTAGGTGGAGTACTCGAGTACTCCACCTAGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-1064s1c1
Sequence:CCGGCCTAATGTTTGGATGTGTCTTCTCGAGAAGACACATCCAAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-751s21c1
Sequence:CCGGGCAGACTTATGTTTCAGGCATCTCGAGATGCCTGAAACATAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-911s21c1
Sequence:CCGGCTTGGATTTCTAGGTGGAGTACTCGAGTACTCCACCTAGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-859s21c1
Sequence:CCGGGTGGGACTATACGATTCCTATCTCGAGATAGGAATCGTATAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-1117s21c1
Sequence:CCGGCCTAATGTTTGGATGTGTCTTCTCGAGAAGACACATCCAAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-1388s21c1
Sequence:CCGGGCACCTGAACAGGTTCAAGTTCTCGAGAACTTGAACCTGTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020244
VALIDATED
CHPT1 MISSION shRNA shRNA Plasmid DNA
choline phosphotransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-1335s1c1
Sequence:CCGGGCACCTGAACAGGTTCAAGTTCTCGAGAACTTGAACCTGTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-698s1c1
Sequence:CCGGGCAGACTTATGTTTCAGGCATCTCGAGATGCCTGAAACATAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-806s1c1
Sequence:CCGGGTGGGACTATACGATTCCTATCTCGAGATAGGAATCGTATAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-858s1c1
Sequence:CCGGCTTGGATTTCTAGGTGGAGTACTCGAGTACTCCACCTAGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-1064s1c1
Sequence:CCGGCCTAATGTTTGGATGTGTCTTCTCGAGAAGACACATCCAAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-751s21c1
Sequence:CCGGGCAGACTTATGTTTCAGGCATCTCGAGATGCCTGAAACATAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-911s21c1
Sequence:CCGGCTTGGATTTCTAGGTGGAGTACTCGAGTACTCCACCTAGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-859s21c1
Sequence:CCGGGTGGGACTATACGATTCCTATCTCGAGATAGGAATCGTATAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-1117s21c1
Sequence:CCGGCCTAATGTTTGGATGTGTCTTCTCGAGAAGACACATCCAAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-1388s21c1
Sequence:CCGGGCACCTGAACAGGTTCAAGTTCTCGAGAACTTGAACCTGTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020244
VALIDATED
CHPT1 MISSION shRNA Lentiviral Transduction Particles
choline phosphotransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-1335s1c1
Sequence:CCGGGCACCTGAACAGGTTCAAGTTCTCGAGAACTTGAACCTGTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-698s1c1
Sequence:CCGGGCAGACTTATGTTTCAGGCATCTCGAGATGCCTGAAACATAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-806s1c1
Sequence:CCGGGTGGGACTATACGATTCCTATCTCGAGATAGGAATCGTATAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-858s1c1
Sequence:CCGGCTTGGATTTCTAGGTGGAGTACTCGAGTACTCCACCTAGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020244.1-1064s1c1
Sequence:CCGGCCTAATGTTTGGATGTGTCTTCTCGAGAAGACACATCCAAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-751s21c1
Sequence:CCGGGCAGACTTATGTTTCAGGCATCTCGAGATGCCTGAAACATAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-911s21c1
Sequence:CCGGCTTGGATTTCTAGGTGGAGTACTCGAGTACTCCACCTAGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-859s21c1
Sequence:CCGGGTGGGACTATACGATTCCTATCTCGAGATAGGAATCGTATAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-1117s21c1
Sequence:CCGGCCTAATGTTTGGATGTGTCTTCTCGAGAAGACACATCCAAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020244.2-1388s21c1
Sequence:CCGGGCACCTGAACAGGTTCAAGTTCTCGAGAACTTGAACCTGTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144807
VALIDATED
CHPT1 MISSION shRNA Bacterial Glycerol Stock
choline phosphotransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144807.2-1525s1c1
Sequence:CCGGGCCAAAGGATTACACAAATATCTCGAGATATTTGTGTAATCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-1136s1c1
Sequence:CCGGCCTTCATCTAAACATCTTCAACTCGAGTTGAAGATGTTTAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144807.2-282s1c1
Sequence:CCGGGCACCATACTGGACATACCTTCTCGAGAAGGTATGTCCAGTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-645s1c1
Sequence:CCGGTGGGACTATACGATACCTATTCTCGAGAATAGGTATCGTATAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-807s1c1
Sequence:CCGGCCTGGACTCCACATAGGATTACTCGAGTAATCCTATGTGGAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144807.3-1754s21c1
Sequence:CCGGTGAGTCAAAGTCAAGTGATATCTCGAGATATCACTTGACTTTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-912s21c1
Sequence:CCGGCCTGGACTCCACATAGGATTACTCGAGTAATCCTATGTGGAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-750s21c1
Sequence:CCGGTGGGACTATACGATACCTATTCTCGAGAATAGGTATCGTATAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-1241s21c1
Sequence:CCGGCCTTCATCTAAACATCTTCAACTCGAGTTGAAGATGTTTAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144807.3-387s21c1
Sequence:CCGGGCACCATACTGGACATACCTTCTCGAGAAGGTATGTCCAGTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144807
VALIDATED
CHPT1 MISSION shRNA shRNA Plasmid DNA
choline phosphotransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144807.2-1525s1c1
Sequence:CCGGGCCAAAGGATTACACAAATATCTCGAGATATTTGTGTAATCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-1136s1c1
Sequence:CCGGCCTTCATCTAAACATCTTCAACTCGAGTTGAAGATGTTTAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144807.2-282s1c1
Sequence:CCGGGCACCATACTGGACATACCTTCTCGAGAAGGTATGTCCAGTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-645s1c1
Sequence:CCGGTGGGACTATACGATACCTATTCTCGAGAATAGGTATCGTATAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-807s1c1
Sequence:CCGGCCTGGACTCCACATAGGATTACTCGAGTAATCCTATGTGGAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144807.3-1754s21c1
Sequence:CCGGTGAGTCAAAGTCAAGTGATATCTCGAGATATCACTTGACTTTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-912s21c1
Sequence:CCGGCCTGGACTCCACATAGGATTACTCGAGTAATCCTATGTGGAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-750s21c1
Sequence:CCGGTGGGACTATACGATACCTATTCTCGAGAATAGGTATCGTATAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-1241s21c1
Sequence:CCGGCCTTCATCTAAACATCTTCAACTCGAGTTGAAGATGTTTAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144807.3-387s21c1
Sequence:CCGGGCACCATACTGGACATACCTTCTCGAGAAGGTATGTCCAGTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144807
VALIDATED
CHPT1 MISSION shRNA Lentiviral Transduction Particles
choline phosphotransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144807.2-1525s1c1
Sequence:CCGGGCCAAAGGATTACACAAATATCTCGAGATATTTGTGTAATCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-1136s1c1
Sequence:CCGGCCTTCATCTAAACATCTTCAACTCGAGTTGAAGATGTTTAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144807.2-282s1c1
Sequence:CCGGGCACCATACTGGACATACCTTCTCGAGAAGGTATGTCCAGTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-645s1c1
Sequence:CCGGTGGGACTATACGATACCTATTCTCGAGAATAGGTATCGTATAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144807.2-807s1c1
Sequence:CCGGCCTGGACTCCACATAGGATTACTCGAGTAATCCTATGTGGAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144807.3-1754s21c1
Sequence:CCGGTGAGTCAAAGTCAAGTGATATCTCGAGATATCACTTGACTTTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-912s21c1
Sequence:CCGGCCTGGACTCCACATAGGATTACTCGAGTAATCCTATGTGGAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-750s21c1
Sequence:CCGGTGGGACTATACGATACCTATTCTCGAGAATAGGTATCGTATAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144807.3-1241s21c1
Sequence:CCGGCCTTCATCTAAACATCTTCAACTCGAGTTGAAGATGTTTAGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144807.3-387s21c1
Sequence:CCGGGCACCATACTGGACATACCTTCTCGAGAAGGTATGTCCAGTATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks