EMAIL THIS PAGE TO A FRIEND

CHRAC1

chromatin accessibility complex 1

62 Gene Product Result for
Synonyms: CHARC1 CHARC15 CHRAC-1 CHRAC-15 CHRAC15 YCL1
UniProtKB ID: Q9NRG0
Gene ID:
Human(54108) Summary: CHRAC1 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004]
Mouse(93696) chromatin accessibility complex 1
Rat(315058) chromatin accessibility complex 1
Zebrafish(503606) chromatin accessibility complex 1
cow(510942) chromatin accessibility complex 1
chicken(100858071) chromatin accessibility complex 1
naked mole-rat(101713171) chromatin accessibility complex 1
domestic guinea pig(100725939) chromatin accessibility complex 1
sheep(101121430) chromatin accessibility complex 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017444 Rosetta Predictions human pricing
NR_023360 Rosetta Predictions human pricing
NM_001134880 Rosetta Predictions rat pricing
NM_053068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093900 predicted 1025
2 SASI_Hs02_00350049 predicted 340
3 SASI_Hs01_00093901 predicted 718
4 SASI_Hs02_00350050 predicted 1020
5 SASI_Hs01_00093902 predicted 944
6 SASI_Hs01_00093903 predicted 706
7 SASI_Hs01_00093904 predicted 403
8 SASI_Hs01_00093905 predicted 928
9 SASI_Hs01_00093906 predicted 564
10 SASI_Hs01_00093907 predicted 236
11 SASI_Hs01_00093899 predicted 549
12 SASI_Hs01_00093908 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381842 predicted 625
2 SASI_Hs02_00381843 predicted 218
3 SASI_Hs02_00381844 predicted 788
4 SASI_Hs02_00381845 predicted 889
5 SASI_Hs02_00381846 predicted 585
6 SASI_Hs02_00381847 predicted 493
7 SASI_Hs02_00381848 predicted 506
8 SASI_Hs02_00381849 predicted 798
9 SASI_Hs02_00381850 predicted 730
10 SASI_Hs02_00381851 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258924 predicted 509
2 SASI_Rn02_00258925 predicted 247
3 SASI_Rn02_00258926 predicted 474
4 SASI_Rn02_00258927 predicted 261
5 SASI_Rn02_00258928 predicted 206
6 SASI_Rn02_00258929 predicted 555
7 SASI_Rn02_00258930 predicted 483
8 SASI_Rn02_00258931 predicted 497
9 SASI_Rn02_00258932 predicted 269
10 SASI_Rn02_00258933 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052113 predicted 205
2 SASI_Mm01_00052114 predicted 487
3 SASI_Mm01_00052118 predicted 499
4 SASI_Mm01_00052119 predicted 475
5 SASI_Mm02_00337518 predicted 429
6 SASI_Mm01_00052120 predicted 516
7 SASI_Mm01_00052121 predicted 465
8 SASI_Mm01_00052122 predicted 240
9 SASI_Mm02_00337519 predicted 600
10 SASI_Mm02_00337520 predicted 232
11 SASI_Mm01_00052115 predicted 493
12 SASI_Mm01_00052116 predicted 280
13 SASI_Mm01_00052117 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053068
CHRAC1 MISSION shRNA Bacterial Glycerol Stock
chromatin accessibility complex 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-237s21c1
Sequence:CCGGCACTGACGTACAGCGACTTAGCTCGAGCTAAGTCGCTGTACGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-408s21c1
Sequence:CCGGTGGCTTAGGCCAGCAAGAAGACTCGAGTCTTCTTGCTGGCCTAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053068.3-650s21c1
Sequence:CCGGACACCACTGAACCTCACATTGCTCGAGCAATGTGAGGTTCAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-319s21c1
Sequence:CCGGTTTAGCTAGTAAGTACCTGAACTCGAGTTCAGGTACTTACTAGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-295s21c1
Sequence:CCGGCGCAGATATATTACCAAAGAACTCGAGTTCTTTGGTAATATATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053068.2-450s1c1
Sequence:CCGGGCACATGCAAGGACAGACTAACTCGAGTTAGTCTGTCCTTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-283s1c1
Sequence:CCGGCACTTCAGTTTCTCGCAGATACTCGAGTATCTGCGAGAAACTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-174s1c1
Sequence:CCGGGAGCTCTTTGTTCAGTACCTACTCGAGTAGGTACTGAACAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-282s1c1
Sequence:CCGGACACTTCAGTTTCTCGCAGATCTCGAGATCTGCGAGAAACTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-296s1c1
Sequence:CCGGCGCAGATATATTACCAAAGAACTCGAGTTCTTTGGTAATATATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053068
CHRAC1 MISSION shRNA shRNA Plasmid DNA
chromatin accessibility complex 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-237s21c1
Sequence:CCGGCACTGACGTACAGCGACTTAGCTCGAGCTAAGTCGCTGTACGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-408s21c1
Sequence:CCGGTGGCTTAGGCCAGCAAGAAGACTCGAGTCTTCTTGCTGGCCTAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053068.3-650s21c1
Sequence:CCGGACACCACTGAACCTCACATTGCTCGAGCAATGTGAGGTTCAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-319s21c1
Sequence:CCGGTTTAGCTAGTAAGTACCTGAACTCGAGTTCAGGTACTTACTAGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-295s21c1
Sequence:CCGGCGCAGATATATTACCAAAGAACTCGAGTTCTTTGGTAATATATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053068.2-450s1c1
Sequence:CCGGGCACATGCAAGGACAGACTAACTCGAGTTAGTCTGTCCTTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-283s1c1
Sequence:CCGGCACTTCAGTTTCTCGCAGATACTCGAGTATCTGCGAGAAACTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-174s1c1
Sequence:CCGGGAGCTCTTTGTTCAGTACCTACTCGAGTAGGTACTGAACAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-282s1c1
Sequence:CCGGACACTTCAGTTTCTCGCAGATCTCGAGATCTGCGAGAAACTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-296s1c1
Sequence:CCGGCGCAGATATATTACCAAAGAACTCGAGTTCTTTGGTAATATATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053068
CHRAC1 MISSION shRNA Lentiviral Transduction Particles
chromatin accessibility complex 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-237s21c1
Sequence:CCGGCACTGACGTACAGCGACTTAGCTCGAGCTAAGTCGCTGTACGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-408s21c1
Sequence:CCGGTGGCTTAGGCCAGCAAGAAGACTCGAGTCTTCTTGCTGGCCTAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053068.3-650s21c1
Sequence:CCGGACACCACTGAACCTCACATTGCTCGAGCAATGTGAGGTTCAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-319s21c1
Sequence:CCGGTTTAGCTAGTAAGTACCTGAACTCGAGTTCAGGTACTTACTAGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053068.3-295s21c1
Sequence:CCGGCGCAGATATATTACCAAAGAACTCGAGTTCTTTGGTAATATATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053068.2-450s1c1
Sequence:CCGGGCACATGCAAGGACAGACTAACTCGAGTTAGTCTGTCCTTGCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-283s1c1
Sequence:CCGGCACTTCAGTTTCTCGCAGATACTCGAGTATCTGCGAGAAACTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-174s1c1
Sequence:CCGGGAGCTCTTTGTTCAGTACCTACTCGAGTAGGTACTGAACAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-282s1c1
Sequence:CCGGACACTTCAGTTTCTCGCAGATCTCGAGATCTGCGAGAAACTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053068.2-296s1c1
Sequence:CCGGCGCAGATATATTACCAAAGAACTCGAGTTCTTTGGTAATATATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017444
VALIDATED
CHRAC1 MISSION shRNA Bacterial Glycerol Stock
chromatin accessibility complex 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017444.4-642s21c1
Sequence:GTACCGGACTCCACTGTCTCTAAGTAAACTCGAGTTTACTTAGAGACAGTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-357s21c1
Sequence:GTACCGGTCAATGCCTAGCCACCTATTCCTCGAGGAATAGGTGGCTAGGCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017444.4-458s21c1
Sequence:CCGGTTCAGTTTCTTGCAGATATATCTCGAGATATATCTGCAAGAAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-493s21c1
Sequence:CCGGTTAGCTAGTAAATACCTGAAACTCGAGTTTCAGGTATTTACTAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017444.4-714s21c1
Sequence:CCGGGTGGTATTCTTTCGAGGTATTCTCGAGAATACCTCGAAAGAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-565s21c1
Sequence:CCGGGAAAGTGACCATGATGAAGCTCTCGAGAGCTTCATCATGGTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-434s21c1
Sequence:CCGGACACTGCACAGCAATCAGAAACTCGAGTTTCTGATTGCTGTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-343s1c1
Sequence:CCGGGAGCTCTTTGTTCAATGCCTACTCGAGTAGGCATTGAACAAAGAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-431s1c1
Sequence:CCGGACACTGCACAGCAATCAGAAACTCGAGTTTCTGATTGCTGTGCAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-238s1c1
Sequence:CCGGCGGCTCATCTCGCTGCCTCTACTCGAGTAGAGGCAGCGAGATGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-410s1c1
Sequence:CCGGTGACTTACAGTGATTTAGCAACTCGAGTTGCTAAATCACTGTAAGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017444.3-562s1c1
Sequence:CCGGGAAAGTGACCATGATGAAGCTCTCGAGAGCTTCATCATGGTCACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017444
VALIDATED
CHRAC1 MISSION shRNA shRNA Plasmid DNA
chromatin accessibility complex 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017444.4-642s21c1
Sequence:GTACCGGACTCCACTGTCTCTAAGTAAACTCGAGTTTACTTAGAGACAGTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-357s21c1
Sequence:GTACCGGTCAATGCCTAGCCACCTATTCCTCGAGGAATAGGTGGCTAGGCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017444.4-458s21c1
Sequence:CCGGTTCAGTTTCTTGCAGATATATCTCGAGATATATCTGCAAGAAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-493s21c1
Sequence:CCGGTTAGCTAGTAAATACCTGAAACTCGAGTTTCAGGTATTTACTAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017444.4-714s21c1
Sequence:CCGGGTGGTATTCTTTCGAGGTATTCTCGAGAATACCTCGAAAGAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-565s21c1
Sequence:CCGGGAAAGTGACCATGATGAAGCTCTCGAGAGCTTCATCATGGTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-434s21c1
Sequence:CCGGACACTGCACAGCAATCAGAAACTCGAGTTTCTGATTGCTGTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-343s1c1
Sequence:CCGGGAGCTCTTTGTTCAATGCCTACTCGAGTAGGCATTGAACAAAGAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-431s1c1
Sequence:CCGGACACTGCACAGCAATCAGAAACTCGAGTTTCTGATTGCTGTGCAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-238s1c1
Sequence:CCGGCGGCTCATCTCGCTGCCTCTACTCGAGTAGAGGCAGCGAGATGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-410s1c1
Sequence:CCGGTGACTTACAGTGATTTAGCAACTCGAGTTGCTAAATCACTGTAAGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017444.3-562s1c1
Sequence:CCGGGAAAGTGACCATGATGAAGCTCTCGAGAGCTTCATCATGGTCACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017444
VALIDATED
CHRAC1 MISSION shRNA Lentiviral Transduction Particles
chromatin accessibility complex 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017444.4-642s21c1
Sequence:GTACCGGACTCCACTGTCTCTAAGTAAACTCGAGTTTACTTAGAGACAGTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-357s21c1
Sequence:GTACCGGTCAATGCCTAGCCACCTATTCCTCGAGGAATAGGTGGCTAGGCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017444.4-458s21c1
Sequence:CCGGTTCAGTTTCTTGCAGATATATCTCGAGATATATCTGCAAGAAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-493s21c1
Sequence:CCGGTTAGCTAGTAAATACCTGAAACTCGAGTTTCAGGTATTTACTAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017444.4-714s21c1
Sequence:CCGGGTGGTATTCTTTCGAGGTATTCTCGAGAATACCTCGAAAGAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-565s21c1
Sequence:CCGGGAAAGTGACCATGATGAAGCTCTCGAGAGCTTCATCATGGTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017444.4-434s21c1
Sequence:CCGGACACTGCACAGCAATCAGAAACTCGAGTTTCTGATTGCTGTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-343s1c1
Sequence:CCGGGAGCTCTTTGTTCAATGCCTACTCGAGTAGGCATTGAACAAAGAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-431s1c1
Sequence:CCGGACACTGCACAGCAATCAGAAACTCGAGTTTCTGATTGCTGTGCAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-238s1c1
Sequence:CCGGCGGCTCATCTCGCTGCCTCTACTCGAGTAGAGGCAGCGAGATGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017444.3-410s1c1
Sequence:CCGGTGACTTACAGTGATTTAGCAACTCGAGTTGCTAAATCACTGTAAGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017444.3-562s1c1
Sequence:CCGGGAAAGTGACCATGATGAAGCTCTCGAGAGCTTCATCATGGTCACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks