EMAIL THIS PAGE TO A FRIEND

CHRD

chordin

109 Gene Product Result for
Gene ID:
Human(8646) Summary: This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12667) chordin
Rat(117275) chordin
chicken(395828) chordin
dog(607289) chordin
cow(509942) chordin
sheep(443243) chordin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0773 Mouse Chrd / Chordin ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003741 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026361 MISSION® esiRNA esiRNA targeting mouse Chrd (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003741 Rosetta Predictions human pricing
XM_001059575 Rosetta Predictions rat pricing
XM_221307 Rosetta Predictions rat pricing
NM_009893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204507 predicted 2959
2 SASI_Hs01_00204509 predicted 732
3 SASI_Hs02_00336196 predicted 1427
4 SASI_Hs02_00336197 predicted 1243
5 SASI_Hs01_00204510 predicted 1815
6 SASI_Hs01_00204511 predicted 3167
7 SASI_Hs01_00204512 predicted 1563
8 SASI_Hs01_00204513 predicted 2432
9 SASI_Hs01_00204514 predicted 2406
10 SASI_Hs01_00204515 predicted 1005
11 SASI_Hs01_00204508 predicted 1489
12 SASI_Hs01_00204516 predicted 3095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293644 predicted 1315
2 SASI_Rn02_00293645 predicted 312
3 SASI_Rn02_00293646 predicted 670
4 SASI_Rn02_00293647 predicted 1297
5 SASI_Rn02_00293648 predicted 580
6 SASI_Rn02_00293649 predicted 1296
7 SASI_Rn02_00293650 predicted 2803
8 SASI_Rn02_00293651 predicted 1496
9 SASI_Rn02_00293652 predicted 1314
10 SASI_Rn02_00293653 predicted 2682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176735 predicted 1311
2 SASI_Rn01_00176736 predicted 313
3 SASI_Rn01_00176737 predicted 527
4 SASI_Rn01_00176739 predicted 665
5 SASI_Rn01_00176740 predicted 1303
6 SASI_Rn01_00176741 predicted 2800
7 SASI_Rn02_00379994 predicted 1344
8 SASI_Rn02_00379995 predicted 1245
9 SASI_Rn01_00176742 predicted 1177
10 SASI_Rn01_00176743 predicted 2989
11 SASI_Rn01_00176738 predicted 517
12 SASI_Rn01_00176744 predicted 2741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145900 predicted 671
2 SASI_Mm01_00145901 predicted 307
3 SASI_Mm01_00145902 predicted 1439
4 SASI_Mm01_00145903 predicted 2800
5 SASI_Mm01_00145904 predicted 1205
6 SASI_Mm01_00145905 predicted 1296
7 SASI_Mm01_00145906 predicted 1314
8 SASI_Mm01_00145907 predicted 1689
9 SASI_Mm01_00145908 predicted 585
10 SASI_Mm01_00145909 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009893
CHRD MISSION shRNA Bacterial Glycerol Stock
chordin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-2106s1c1
Sequence:CCGGCCGAGATCCTAACACATGTTTCTCGAGAAACATGTGTTAGGATCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1289s1c1
Sequence:CCGGCCAGCTTCATATTGCTAGGAACTCGAGTTCCTAGCAATATGAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1798s1c1
Sequence:CCGGCGGCTGCTGAAGGGATTCTATCTCGAGATAGAATCCCTTCAGCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-670s1c1
Sequence:CCGGACAGGCAACATCCTGTTTGAACTCGAGTTCAAACAGGATGTTGCCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1179s1c1
Sequence:CCGGGCTACGCATCAGTGGATACATCTCGAGATGTATCCACTGATGCGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1307s21c1
Sequence:CCGGGAAATGGCTCCCTTATCTATCCTCGAGGATAGATAAGGGAGCCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1701s21c1
Sequence:CCGGCTTACACTATGAAGTTCTATTCTCGAGAATAGAACTTCATAGTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-589s21c1
Sequence:CCGGTCTTTGCTGCGCTCAAGTTTACTCGAGTAAACTTGAGCGCAGCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1281s21c1
Sequence:CCGGTGGGTCAGCCAGCTTCATATTCTCGAGAATATGAAGCTGGCTGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009893
CHRD MISSION shRNA shRNA Plasmid DNA
chordin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-2106s1c1
Sequence:CCGGCCGAGATCCTAACACATGTTTCTCGAGAAACATGTGTTAGGATCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1289s1c1
Sequence:CCGGCCAGCTTCATATTGCTAGGAACTCGAGTTCCTAGCAATATGAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1798s1c1
Sequence:CCGGCGGCTGCTGAAGGGATTCTATCTCGAGATAGAATCCCTTCAGCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-670s1c1
Sequence:CCGGACAGGCAACATCCTGTTTGAACTCGAGTTCAAACAGGATGTTGCCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1179s1c1
Sequence:CCGGGCTACGCATCAGTGGATACATCTCGAGATGTATCCACTGATGCGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1307s21c1
Sequence:CCGGGAAATGGCTCCCTTATCTATCCTCGAGGATAGATAAGGGAGCCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1701s21c1
Sequence:CCGGCTTACACTATGAAGTTCTATTCTCGAGAATAGAACTTCATAGTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-589s21c1
Sequence:CCGGTCTTTGCTGCGCTCAAGTTTACTCGAGTAAACTTGAGCGCAGCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1281s21c1
Sequence:CCGGTGGGTCAGCCAGCTTCATATTCTCGAGAATATGAAGCTGGCTGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009893
CHRD MISSION shRNA Lentiviral Transduction Particles
chordin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-2106s1c1
Sequence:CCGGCCGAGATCCTAACACATGTTTCTCGAGAAACATGTGTTAGGATCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1289s1c1
Sequence:CCGGCCAGCTTCATATTGCTAGGAACTCGAGTTCCTAGCAATATGAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1798s1c1
Sequence:CCGGCGGCTGCTGAAGGGATTCTATCTCGAGATAGAATCCCTTCAGCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-670s1c1
Sequence:CCGGACAGGCAACATCCTGTTTGAACTCGAGTTCAAACAGGATGTTGCCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009893.1-1179s1c1
Sequence:CCGGGCTACGCATCAGTGGATACATCTCGAGATGTATCCACTGATGCGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1307s21c1
Sequence:CCGGGAAATGGCTCCCTTATCTATCCTCGAGGATAGATAAGGGAGCCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1701s21c1
Sequence:CCGGCTTACACTATGAAGTTCTATTCTCGAGAATAGAACTTCATAGTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-589s21c1
Sequence:CCGGTCTTTGCTGCGCTCAAGTTTACTCGAGTAAACTTGAGCGCAGCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009893.2-1281s21c1
Sequence:CCGGTGGGTCAGCCAGCTTCATATTCTCGAGAATATGAAGCTGGCTGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003741
CHRD MISSION shRNA Bacterial Glycerol Stock
chordin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-2531s1c1
Sequence:CCGGGCCCTGAGAAACAAGATGTCACTCGAGTGACATCTTGTTTCTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-1457s1c1
Sequence:CCGGACGTCCTGCAAAGTGTCCTTTCTCGAGAAAGGACACTTTGCAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-345s1c1
Sequence:CCGGGCTGCCCATCCGTTCTGAGAACTCGAGTTCTCAGAACGGATGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-3076s1c1
Sequence:CCGGACTGATCCAGAGCTGGAGAAACTCGAGTTTCTCCAGCTCTGGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-831s1c1
Sequence:CCGGCCTCCGCTTCTCTATCTCCTACTCGAGTAGGAGATAGAGAAGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003741
CHRD MISSION shRNA shRNA Plasmid DNA
chordin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-2531s1c1
Sequence:CCGGGCCCTGAGAAACAAGATGTCACTCGAGTGACATCTTGTTTCTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-1457s1c1
Sequence:CCGGACGTCCTGCAAAGTGTCCTTTCTCGAGAAAGGACACTTTGCAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-345s1c1
Sequence:CCGGGCTGCCCATCCGTTCTGAGAACTCGAGTTCTCAGAACGGATGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-3076s1c1
Sequence:CCGGACTGATCCAGAGCTGGAGAAACTCGAGTTTCTCCAGCTCTGGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-831s1c1
Sequence:CCGGCCTCCGCTTCTCTATCTCCTACTCGAGTAGGAGATAGAGAAGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003741
CHRD MISSION shRNA Lentiviral Transduction Particles
chordin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-2531s1c1
Sequence:CCGGGCCCTGAGAAACAAGATGTCACTCGAGTGACATCTTGTTTCTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-1457s1c1
Sequence:CCGGACGTCCTGCAAAGTGTCCTTTCTCGAGAAAGGACACTTTGCAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-345s1c1
Sequence:CCGGGCTGCCCATCCGTTCTGAGAACTCGAGTTCTCAGAACGGATGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-3076s1c1
Sequence:CCGGACTGATCCAGAGCTGGAGAAACTCGAGTTTCTCCAGCTCTGGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003741.2-831s1c1
Sequence:CCGGCCTCCGCTTCTCTATCTCCTACTCGAGTAGGAGATAGAGAAGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)