EMAIL THIS PAGE TO A FRIEND

CHRDL1

chordin-like 1

99 Gene Product Result for
Synonyms: CHL NRLN1 VOPT dA141H5.1
Gene ID:
Human(91851) Summary: This gene encodes an antagonist of bone morphogenetic protein 4. The encoded protein may play a role in topographic retinotectal projection and in the regulation of retinal angiogenesis in response to hypoxia. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009]
Mouse(83453) chordin-like 1
Rat(363455) chordin-like 1
naked mole-rat(101713654) chordin-like 1
sheep(101113311) chordin-like 1
chicken(373985) chordin-like 1
domestic cat(101091681) chordin-like 1
cow(540275) chordin-like 1
Horse(100059105) chordin-like 1
dog(492066) chordin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145234 Rosetta Predictions human pricing
NM_199502 Rosetta Predictions rat pricing
NM_001114385 Rosetta Predictions mouse pricing
NM_031258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088254 predicted 264
2 SASI_Hs02_00365072 predicted 972
3 SASI_Hs01_00088255 predicted 1258
4 SASI_Hs02_00365073 predicted 330
5 SASI_Hs01_00088256 predicted 310
6 SASI_Hs01_00088257 predicted 1495
7 SASI_Hs01_00088259 predicted 450
8 SASI_Hs01_00088261 predicted 351
9 SASI_Hs01_00088262 predicted 657
10 SASI_Hs01_00088263 predicted 1575
11 SASI_Hs01_00088258 predicted 1417
12 SASI_Hs01_00088260 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112363 predicted 1874
2 SASI_Rn01_00112364 predicted 574
3 SASI_Rn01_00112365 predicted 997
4 SASI_Rn01_00112367 predicted 1537
5 SASI_Rn01_00112368 predicted 1463
6 SASI_Rn01_00112369 predicted 1297
7 SASI_Rn01_00112370 predicted 291
8 SASI_Rn01_00112371 predicted 1096
9 SASI_Rn02_00270275 predicted 653
10 SASI_Rn02_00270276 predicted 1209
11 SASI_Rn01_00112366 predicted 1426
12 SASI_Rn01_00112372 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308608 predicted 642
2 SASI_Mm02_00308609 predicted 853
3 SASI_Mm02_00308610 predicted 1057
4 SASI_Mm02_00308611 predicted 1020
5 SASI_Mm02_00308612 predicted 704
6 SASI_Mm02_00308613 predicted 605
7 SASI_Mm02_00308614 predicted 1154
8 SASI_Mm02_00308615 predicted 1242
9 SASI_Mm02_00308616 predicted 874
10 SASI_Mm02_00308617 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337084 predicted 844
2 SASI_Mm02_00337085 predicted 1063
3 SASI_Mm01_00116362 predicted 1014
4 SASI_Mm01_00116363 predicted 706
5 SASI_Mm02_00337086 predicted 607
6 SASI_Mm01_00116366 predicted 1154
7 SASI_Mm02_00337087 predicted 1242
8 SASI_Mm02_00337088 predicted 876
9 SASI_Mm02_00337089 predicted 635
10 SASI_Mm02_00337090 predicted 809
11 SASI_Mm01_00116357 predicted 1447
12 SASI_Mm01_00116358 predicted 1513
13 SASI_Mm01_00116359 predicted 574
14 SASI_Mm01_00116360 predicted 1470
15 SASI_Mm01_00116361 predicted 1282
16 SASI_Mm01_00116364 predicted 1295
17 SASI_Mm01_00116365 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145234
CHRDL1 MISSION shRNA Bacterial Glycerol Stock
chordin-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145234.3-1691s21c1
Sequence:CCGGACGCCATGCACAGCATAATTTCTCGAGAAATTATGCTGTGCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145234.3-1669s21c1
Sequence:CCGGACTCAAATGCAGTCAATTATTCTCGAGAATAATTGACTGCATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-353s1c1
Sequence:CCGGGTCCAAATGTTCATTGCCTTTCTCGAGAAAGGCAATGAACATTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-659s1c1
Sequence:CCGGGAGAACTGTCATGGGAACATTCTCGAGAATGTTCCCATGACAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-836s1c1
Sequence:CCGGCATCAGGAACCATTGTGCAAACTCGAGTTTGCACAATGGTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145234.2-2254s1c1
Sequence:CCGGGCCTCATTCATTCACTTAGAACTCGAGTTCTAAGTGAATGAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145234.2-2200s1c1
Sequence:CCGGGCTGTTTAAGTCACCAACAATCTCGAGATTGTTGGTGACTTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145234
CHRDL1 MISSION shRNA shRNA Plasmid DNA
chordin-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145234.3-1691s21c1
Sequence:CCGGACGCCATGCACAGCATAATTTCTCGAGAAATTATGCTGTGCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145234.3-1669s21c1
Sequence:CCGGACTCAAATGCAGTCAATTATTCTCGAGAATAATTGACTGCATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-353s1c1
Sequence:CCGGGTCCAAATGTTCATTGCCTTTCTCGAGAAAGGCAATGAACATTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-659s1c1
Sequence:CCGGGAGAACTGTCATGGGAACATTCTCGAGAATGTTCCCATGACAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-836s1c1
Sequence:CCGGCATCAGGAACCATTGTGCAAACTCGAGTTTGCACAATGGTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145234.2-2254s1c1
Sequence:CCGGGCCTCATTCATTCACTTAGAACTCGAGTTCTAAGTGAATGAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145234.2-2200s1c1
Sequence:CCGGGCTGTTTAAGTCACCAACAATCTCGAGATTGTTGGTGACTTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145234
CHRDL1 MISSION shRNA Lentiviral Transduction Particles
chordin-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145234.3-1691s21c1
Sequence:CCGGACGCCATGCACAGCATAATTTCTCGAGAAATTATGCTGTGCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145234.3-1669s21c1
Sequence:CCGGACTCAAATGCAGTCAATTATTCTCGAGAATAATTGACTGCATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-353s1c1
Sequence:CCGGGTCCAAATGTTCATTGCCTTTCTCGAGAAAGGCAATGAACATTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-659s1c1
Sequence:CCGGGAGAACTGTCATGGGAACATTCTCGAGAATGTTCCCATGACAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145234.2-836s1c1
Sequence:CCGGCATCAGGAACCATTGTGCAAACTCGAGTTTGCACAATGGTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145234.2-2254s1c1
Sequence:CCGGGCCTCATTCATTCACTTAGAACTCGAGTTCTAAGTGAATGAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145234.2-2200s1c1
Sequence:CCGGGCTGTTTAAGTCACCAACAATCTCGAGATTGTTGGTGACTTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031258
CHRDL1 MISSION shRNA Bacterial Glycerol Stock
chordin-like 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031258.2-1250s1c1
Sequence:CCGGGCACCCAAATCTACGAGCATTCTCGAGAATGCTCGTAGATTTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031258.2-2106s1c1
Sequence:CCGGCCATTCATTCTAATGGCATTTCTCGAGAAATGCCATTAGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-975s1c1
Sequence:CCGGGCAGAATTATCGTGGGAACATCTCGAGATGTTCCCACGATAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-1166s1c1
Sequence:CCGGCGTGCAGATTGTCATCAATAACTCGAGTTATTGATGACAATCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031258.2-2989s1c1
Sequence:CCGGGCAGCACCTAAGAGATCATTACTCGAGTAATGATCTCTTAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-775s1c1
Sequence:CCGGGCGAATACAATGGAACCACTTCTCGAGAAGTGGTTCCATTGTATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031258
CHRDL1 MISSION shRNA shRNA Plasmid DNA
chordin-like 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031258.2-1250s1c1
Sequence:CCGGGCACCCAAATCTACGAGCATTCTCGAGAATGCTCGTAGATTTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031258.2-2106s1c1
Sequence:CCGGCCATTCATTCTAATGGCATTTCTCGAGAAATGCCATTAGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-975s1c1
Sequence:CCGGGCAGAATTATCGTGGGAACATCTCGAGATGTTCCCACGATAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-1166s1c1
Sequence:CCGGCGTGCAGATTGTCATCAATAACTCGAGTTATTGATGACAATCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031258.2-2989s1c1
Sequence:CCGGGCAGCACCTAAGAGATCATTACTCGAGTAATGATCTCTTAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-775s1c1
Sequence:CCGGGCGAATACAATGGAACCACTTCTCGAGAAGTGGTTCCATTGTATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031258
CHRDL1 MISSION shRNA Lentiviral Transduction Particles
chordin-like 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031258.2-1250s1c1
Sequence:CCGGGCACCCAAATCTACGAGCATTCTCGAGAATGCTCGTAGATTTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031258.2-2106s1c1
Sequence:CCGGCCATTCATTCTAATGGCATTTCTCGAGAAATGCCATTAGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-975s1c1
Sequence:CCGGGCAGAATTATCGTGGGAACATCTCGAGATGTTCCCACGATAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-1166s1c1
Sequence:CCGGCGTGCAGATTGTCATCAATAACTCGAGTTATTGATGACAATCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031258.2-2989s1c1
Sequence:CCGGGCAGCACCTAAGAGATCATTACTCGAGTAATGATCTCTTAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031258.2-775s1c1
Sequence:CCGGGCGAATACAATGGAACCACTTCTCGAGAAGTGGTTCCATTGTATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks