EMAIL THIS PAGE TO A FRIEND

CHRDL2

chordin-like 2

Synonyms: BNF1 CHL2 FKSG37
UniProtKB ID: Q6WN34, A5PKU9, Q6WN30, Q6WN31, Q6WN32, Q7Z5J3
Gene ID:
Mouse(69121) chordin-like 2
Rat(308854) chordin-like 2
Zebrafish(563085) chordin-like 2
cow(533631) chordin-like 2
Horse(100065017) chordin-like 2
domestic cat(101093460) chordin-like 2
dog(609312) chordin-like 2
chicken(419054) chordin-like 2
sheep(101106877) chordin-like 2
naked mole-rat(101707437) chordin-like 2
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015424 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015424 Rosetta Predictions human pricing
NM_001107537 Rosetta Predictions rat pricing
NM_133709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066267 predicted 684
2 SASI_Hs01_00066268 predicted 513
3 SASI_Hs01_00066270 predicted 521
4 SASI_Hs01_00066271 predicted 959
5 SASI_Hs01_00066272 predicted 592
6 SASI_Hs01_00066274 predicted 411
7 SASI_Hs01_00066275 predicted 774
8 SASI_Hs01_00066276 predicted 825
9 SASI_Hs02_00347806 predicted 509
10 SASI_Hs02_00347807 predicted 330
11 SASI_Hs01_00066269 predicted 978
12 SASI_Hs01_00066273 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229805 predicted 1057
2 SASI_Rn02_00229806 predicted 863
3 SASI_Rn02_00229807 predicted 1214
4 SASI_Rn02_00229808 predicted 1276
5 SASI_Rn02_00229809 predicted 717
6 SASI_Rn02_00229810 predicted 583
7 SASI_Rn02_00229811 predicted 656
8 SASI_Rn02_00229812 predicted 320
9 SASI_Rn02_00229813 predicted 407
10 SASI_Rn02_00229814 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037034 predicted 1016
2 SASI_Mm01_00037035 predicted 807
3 SASI_Mm01_00037036 predicted 552
4 SASI_Mm01_00037037 predicted 1227
5 SASI_Mm01_00037038 predicted 562
6 SASI_Mm01_00037039 predicted 718
7 SASI_Mm01_00037040 predicted 321
8 SASI_Mm01_00037041 predicted 954
9 SASI_Mm01_00037042 predicted 819
10 SASI_Mm01_00037043 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133709
CHRDL2 MISSION shRNA Bacterial Glycerol Stock
chordin-like 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-1076s1c1
Sequence:CCGGGATGACCACAGTGAGGTCATTCTCGAGAATGACCTCACTGTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-1199s1c1
Sequence:CCGGGACCAGGTAGAGATGTACATTCTCGAGAATGTACATCTCTACCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-552s1c1
Sequence:CCGGGCTGTATTGAAGGCCACACTTCTCGAGAAGTGTGGCCTTCAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-322s1c1
Sequence:CCGGGAATGGACATGTGAATTGTTACTCGAGTAACAATTCACATGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133709
CHRDL2 MISSION shRNA shRNA Plasmid DNA
chordin-like 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-1076s1c1
Sequence:CCGGGATGACCACAGTGAGGTCATTCTCGAGAATGACCTCACTGTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-1199s1c1
Sequence:CCGGGACCAGGTAGAGATGTACATTCTCGAGAATGTACATCTCTACCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-552s1c1
Sequence:CCGGGCTGTATTGAAGGCCACACTTCTCGAGAAGTGTGGCCTTCAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-322s1c1
Sequence:CCGGGAATGGACATGTGAATTGTTACTCGAGTAACAATTCACATGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133709
CHRDL2 MISSION shRNA Lentiviral Transduction Particles
chordin-like 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-1076s1c1
Sequence:CCGGGATGACCACAGTGAGGTCATTCTCGAGAATGACCTCACTGTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-1199s1c1
Sequence:CCGGGACCAGGTAGAGATGTACATTCTCGAGAATGTACATCTCTACCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-552s1c1
Sequence:CCGGGCTGTATTGAAGGCCACACTTCTCGAGAAGTGTGGCCTTCAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133709.2-322s1c1
Sequence:CCGGGAATGGACATGTGAATTGTTACTCGAGTAACAATTCACATGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015424
CHRDL2 MISSION shRNA Bacterial Glycerol Stock
chordin-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1454s1c1
Sequence:CCGGGAAAGTCAGGAAGCAAGACTTCTCGAGAAGTCTTGCTTCCTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-982s1c1
Sequence:CCGGCCTGAAGGAGAAACATAAGAACTCGAGTTCTTATGTTTCTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-991s1c1
Sequence:CCGGGAAACATAAGAAAGCCTGTGTCTCGAGACACAGGCTTTCTTATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1437s1c1
Sequence:CCGGCACTTGACTCAGATCAAGAAACTCGAGTTTCTTGATCTGAGTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-785s1c1
Sequence:CCGGGCAAGTGAGCAATCGGATGAACTCGAGTTCATCCGATTGCTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1460s1c1
Sequence:CCGGCAGGAAGCAAGACTTCCAGAACTCGAGTTCTGGAAGTCTTGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-995s1c1
Sequence:CCGGCATAAGAAAGCCTGTGTGCATCTCGAGATGCACACAGGCTTTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1433s1c1
Sequence:CCGGCTTCCACTTGACTCAGATCAACTCGAGTTGATCTGAGTCAAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015424
CHRDL2 MISSION shRNA shRNA Plasmid DNA
chordin-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1454s1c1
Sequence:CCGGGAAAGTCAGGAAGCAAGACTTCTCGAGAAGTCTTGCTTCCTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-982s1c1
Sequence:CCGGCCTGAAGGAGAAACATAAGAACTCGAGTTCTTATGTTTCTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-991s1c1
Sequence:CCGGGAAACATAAGAAAGCCTGTGTCTCGAGACACAGGCTTTCTTATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1437s1c1
Sequence:CCGGCACTTGACTCAGATCAAGAAACTCGAGTTTCTTGATCTGAGTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-785s1c1
Sequence:CCGGGCAAGTGAGCAATCGGATGAACTCGAGTTCATCCGATTGCTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1460s1c1
Sequence:CCGGCAGGAAGCAAGACTTCCAGAACTCGAGTTCTGGAAGTCTTGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-995s1c1
Sequence:CCGGCATAAGAAAGCCTGTGTGCATCTCGAGATGCACACAGGCTTTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1433s1c1
Sequence:CCGGCTTCCACTTGACTCAGATCAACTCGAGTTGATCTGAGTCAAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015424
CHRDL2 MISSION shRNA Lentiviral Transduction Particles
chordin-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1454s1c1
Sequence:CCGGGAAAGTCAGGAAGCAAGACTTCTCGAGAAGTCTTGCTTCCTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-982s1c1
Sequence:CCGGCCTGAAGGAGAAACATAAGAACTCGAGTTCTTATGTTTCTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-991s1c1
Sequence:CCGGGAAACATAAGAAAGCCTGTGTCTCGAGACACAGGCTTTCTTATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1437s1c1
Sequence:CCGGCACTTGACTCAGATCAAGAAACTCGAGTTTCTTGATCTGAGTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-785s1c1
Sequence:CCGGGCAAGTGAGCAATCGGATGAACTCGAGTTCATCCGATTGCTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1460s1c1
Sequence:CCGGCAGGAAGCAAGACTTCCAGAACTCGAGTTCTGGAAGTCTTGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-995s1c1
Sequence:CCGGCATAAGAAAGCCTGTGTGCATCTCGAGATGCACACAGGCTTTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015424.3-1433s1c1
Sequence:CCGGCTTCCACTTGACTCAGATCAACTCGAGTTGATCTGAGTCAAGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks