EMAIL THIS PAGE TO A FRIEND

CHRFAM7A

CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion

44 Gene Product Result for
Synonyms: CHRNA7 CHRNA7-DR1 D-10
Species: Human CHRFAM7A(89832)
UniProtKB ID: Q494W8, A8KAB9
Gene ID:
Human(89832) Summary: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The family member CHRNA7, which is located on chromosome 15 in a region associated with several neuropsychiatric disorders, is partially duplicated and forms a hybrid with a novel gene from the family with sequence similarity 7 (FAM7A). Alternative splicing has been observed, and two variants exist, for this hybrid gene. The N-terminally truncated products predicted by the largest open reading frames for each variant would lack the majority of the neurotransmitter-gated ion-channel ligand binding domain but retain the transmembrane region that forms the ion channel. Although current evidence supports transcription of this hybrid gene, translation of the nicotinic acetylcholine receptor-like protein-encoding open reading frames has not been confirmed. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35409 Anti-CHRFAM7A antibody produced in rabbit affinity isolated antibody zebrafish, bovine, rat, rabbit, canine, horse, human, mouse, guinea pig
western blot pricing
SAB2100423 Anti-CHRFAM7A antibody produced in rabbit affinity isolated antibody bovine, pig, mouse, guinea pig, zebrafish, rat, rabbit, horse, human
western blot pricing
SAB2104658 Anti-CHRFAM7A antibody produced in rabbit affinity isolated antibody pig, rat, horse, zebrafish, human, bovine, mouse, guinea pig, rabbit
western blot pricing
AV35418 Anti-CHRNA7 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, rat, bovine, human, rabbit, guinea pig, pig, mouse
western blot pricing
HPA029422 Anti-CHRNA7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139320 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113741 MISSION® esiRNA esiRNA human CHRFAM7A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139320 Rosetta Predictions human pricing
NM_148911 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014100 predicted 841
2 SASI_Hs01_00014101 predicted 1842
3 SASI_Hs01_00014102 predicted 1151
4 SASI_Hs02_00364288 predicted 1848
5 SASI_Hs02_00364289 predicted 1847
6 SASI_Hs01_00014107 predicted 1106
7 SASI_Hs02_00364290 predicted 1147
8 SASI_Hs02_00364291 predicted 1917
9 SASI_Hs02_00364292 predicted 848
10 SASI_Hs02_00364293 predicted 909
11 SASI_Hs01_00014103 predicted 1293
12 SASI_Hs01_00014104 predicted 915
13 SASI_Hs01_00014105 predicted 950
14 SASI_Hs01_00014106 predicted 1879
15 SASI_Hs01_00014108 predicted 2010
16 SASI_Hs01_00014109 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134849 predicted 774
2 SASI_Hs01_00134850 predicted 1785
3 SASI_Hs01_00134851 predicted 1081
4 SASI_Hs02_00365637 predicted 1779
5 SASI_Hs02_00365638 predicted 1784
6 SASI_Hs01_00134856 predicted 1040
7 SASI_Hs02_00365639 predicted 1091
8 SASI_Hs02_00365640 predicted 1850
9 SASI_Hs02_00365641 predicted 778
10 SASI_Hs02_00365642 predicted 847
11 SASI_Hs01_00134852 predicted 1222
12 SASI_Hs01_00134853 predicted 858
13 SASI_Hs01_00134854 predicted 889
14 SASI_Hs01_00134855 predicted 1808
15 SASI_Hs01_00134857 predicted 1944
16 SASI_Hs01_00134858 predicted 1871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139320
CHRFAM7A MISSION shRNA Bacterial Glycerol Stock
CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-633s1c1
Sequence:CCGGGCAAACTGCGATATTGCTGATCTCGAGATCAGCAATATCGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-1784s1c1
Sequence:CCGGCGTGTCCAAAGACTTTGCGTACTCGAGTACGCAAAGTCTTTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-642s1c1
Sequence:CCGGGATATTGCTGATGAGCGCTTTCTCGAGAAAGCGCTCATCAGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-617s1c1
Sequence:CCGGGCATTTGTGGATAGCTGCAAACTCGAGTTTGCAGCTATCCACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-779s1c1
Sequence:CCGGGCAGCACTGCAAACTGAAGTTCTCGAGAACTTCAGTTTGCAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-594s21c1
Sequence:CCGGTTTCAGTTCCAATTGCTAATCCTCGAGGATTAGCAATTGGAACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-848s21c1
Sequence:CCGGGGCAGATATCAGTGGCTATATCTCGAGATATAGCCACTGATATCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-714s21c1
Sequence:CCGGTACCTGCCTCCAGGCATATTCCTCGAGGAATATGCCTGGAGGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139320.1-2602s21c1
Sequence:CCGGCAGAACCCATAGGACAAATAACTCGAGTTATTTGTCCTATGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-907s21c1
Sequence:CCGGAGAGGAGTGAAAGGTTCTATGCTCGAGCATAGAACCTTTCACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139320
CHRFAM7A MISSION shRNA shRNA Plasmid DNA
CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-633s1c1
Sequence:CCGGGCAAACTGCGATATTGCTGATCTCGAGATCAGCAATATCGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-1784s1c1
Sequence:CCGGCGTGTCCAAAGACTTTGCGTACTCGAGTACGCAAAGTCTTTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-642s1c1
Sequence:CCGGGATATTGCTGATGAGCGCTTTCTCGAGAAAGCGCTCATCAGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-617s1c1
Sequence:CCGGGCATTTGTGGATAGCTGCAAACTCGAGTTTGCAGCTATCCACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-779s1c1
Sequence:CCGGGCAGCACTGCAAACTGAAGTTCTCGAGAACTTCAGTTTGCAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-594s21c1
Sequence:CCGGTTTCAGTTCCAATTGCTAATCCTCGAGGATTAGCAATTGGAACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-848s21c1
Sequence:CCGGGGCAGATATCAGTGGCTATATCTCGAGATATAGCCACTGATATCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-714s21c1
Sequence:CCGGTACCTGCCTCCAGGCATATTCCTCGAGGAATATGCCTGGAGGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139320.1-2602s21c1
Sequence:CCGGCAGAACCCATAGGACAAATAACTCGAGTTATTTGTCCTATGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-907s21c1
Sequence:CCGGAGAGGAGTGAAAGGTTCTATGCTCGAGCATAGAACCTTTCACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139320
CHRFAM7A MISSION shRNA Lentiviral Transduction Particles
CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-633s1c1
Sequence:CCGGGCAAACTGCGATATTGCTGATCTCGAGATCAGCAATATCGCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-1784s1c1
Sequence:CCGGCGTGTCCAAAGACTTTGCGTACTCGAGTACGCAAAGTCTTTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-642s1c1
Sequence:CCGGGATATTGCTGATGAGCGCTTTCTCGAGAAAGCGCTCATCAGCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-617s1c1
Sequence:CCGGGCATTTGTGGATAGCTGCAAACTCGAGTTTGCAGCTATCCACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139320.1-779s1c1
Sequence:CCGGGCAGCACTGCAAACTGAAGTTCTCGAGAACTTCAGTTTGCAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-594s21c1
Sequence:CCGGTTTCAGTTCCAATTGCTAATCCTCGAGGATTAGCAATTGGAACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-848s21c1
Sequence:CCGGGGCAGATATCAGTGGCTATATCTCGAGATATAGCCACTGATATCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-714s21c1
Sequence:CCGGTACCTGCCTCCAGGCATATTCCTCGAGGAATATGCCTGGAGGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139320.1-2602s21c1
Sequence:CCGGCAGAACCCATAGGACAAATAACTCGAGTTATTTGTCCTATGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139320.1-907s21c1
Sequence:CCGGAGAGGAGTGAAAGGTTCTATGCTCGAGCATAGAACCTTTCACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks