EMAIL THIS PAGE TO A FRIEND

CHRM1

cholinergic receptor, muscarinic 1

172 Gene Product Result for
Synonyms: HM1 M1 M1R
UniProtKB ID: P11229
Gene ID:
Human(1128) Summary: The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
Mouse(12669) cholinergic receptor, muscarinic 1, CNS
Rat(25229) cholinergic receptor, muscarinic 1
cow(281684) cholinergic receptor, muscarinic 1
Horse(100064117) cholinergic receptor, muscarinic 1
domestic cat(101093801) cholinergic receptor, muscarinic 1
domestic cat(493664) cholinergic receptor, muscarinic 1
dog(483776) cholinergic receptor, muscarinic 1
naked mole-rat(101702102) cholinergic receptor, muscarinic 1
domestic guinea pig(100728041) cholinergic receptor, muscarinic 1
sheep(101117029) cholinergic receptor, muscarinic 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S1875 (−)-Scopolamine hydrobromide trihydrate ≥98% (HPLC), powder human pricing
S8502 (−)-Scopolamine methyl bromide ≥98% (HPLC), powder human pricing
S7882 (−)-Scopolamine N-butyl bromide ≥98% (TLC), powder human pricing
S2250 (−)Scopolamine methyl nitrate human pricing
A6883 Atropine methyl bromide ≥99% (TLC), powder human pricing
A0257 Atropine sulfate salt monohydrate ≥97% (TLC), crystalline human pricing
D7909 Dicyclomine hydrochloride ≥99% (TLC), powder human pricing
T1516 DL-Trihexyphenidyl hydrochloride solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
G8134 Gallamine triethiodide ≥98% (TLC), powder, muscarinic receptor antagonist human pricing
I1637 Ipratropium bromide monohydrate ≥98% (TLC), powder human pricing
O2881 Oxybutynin chloride ≥98% (TLC), powder human pricing
P7412 Pirenzepine dihydrochloride ≥98% (TLC), powder human pricing
P8891 Propantheline bromide ≥97% (TLC), powder human pricing
T122 Telenzepine dihydrochloride hydrate solid, ≥98% (HPLC) human pricing
A0132 Atropine ≥99% (TLC), powder human, mouse, rat pricing
A2468 Atropine meets USP testing specifications human, mouse, rat pricing
C4382 Carbamoylcholine chloride ≥98% (titration), crystalline human, mouse, rat pricing
C2409 Carbamoylcholine chloride 99% human, mouse, rat pricing
C8912 Cocaine free base human, mouse, rat pricing
E8375 Eserine human, mouse, rat pricing
45710 Eserine ≥98.0% (N) human, mouse, rat pricing
P127 (+)-Pentazocine solid human, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline human, rat pricing
C7041 McN-A-343 ≥98% (TLC) human, rat pricing
C003 (R)-(−)-3-Quinuclidinyl benzilate rat pricing
197602 Quinuclidine 97% rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8404 Amitriptyline hydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
A138 Aminobenztropine solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009821 MISSION® esiRNA esiRNA targeting human CHRM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000738 Rosetta Predictions human pricing
NM_080773 Rosetta Predictions rat pricing
NM_001112697 Rosetta Predictions mouse pricing
NM_007698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076782 predicted 2116
2 SASI_Hs01_00076783 predicted 516
3 SASI_Hs01_00076784 predicted 2110
4 SASI_Hs01_00076786 predicted 562
5 SASI_Hs02_00303167 predicted 1924
6 SASI_Hs01_00076787 predicted 1004
7 SASI_Hs01_00076788 predicted 470
8 SASI_Hs01_00076789 predicted 1368
9 SASI_Hs01_00076790 predicted 1008
10 SASI_Hs01_00076791 predicted 1535
11 SASI_Hs01_00076785 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111439 predicted 909
2 SASI_Rn01_00111447 predicted 934
3 SASI_Rn01_00111441 predicted 1031
4 SASI_Rn01_00111442 predicted 600
5 SASI_Rn01_00111443 predicted 477
6 SASI_Rn01_00111444 predicted 974
7 SASI_Rn01_00111445 predicted 591
8 SASI_Rn01_00111446 predicted 1034
9 SASI_Rn02_00267295 predicted 539
10 SASI_Rn02_00267296 predicted 1132
11 SASI_Rn01_00111440 predicted 886
12 SASI_Rn01_00111448 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306893 predicted 1243
2 SASI_Mm02_00306894 predicted 1647
3 SASI_Mm02_00306895 predicted 2145
4 SASI_Mm02_00306896 predicted 2047
5 SASI_Mm02_00306897 predicted 2263
6 SASI_Mm02_00306898 predicted 967
7 SASI_Mm02_00306899 predicted 975
8 SASI_Mm02_00306900 predicted 1868
9 SASI_Mm02_00306901 predicted 1584
10 SASI_Mm02_00306902 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312250 predicted 1149
2 SASI_Mm01_00114591 predicted 1552
3 SASI_Mm02_00312251 predicted 2058
4 SASI_Mm01_00114592 predicted 1955
5 SASI_Mm02_00312252 predicted 2173
6 SASI_Mm01_00114593 predicted 871
7 SASI_Mm01_00114594 predicted 881
8 SASI_Mm01_00114595 predicted 1779
9 SASI_Mm01_00114596 predicted 1496
10 SASI_Mm01_00114598 predicted 1119
11 SASI_Mm01_00114597 predicted 772
12 SASI_Mm01_00114599 predicted 431
13 SASI_Mm01_00114600 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000738
CHRM1 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-1651s21c1
Sequence:CCGGGCTACGCACTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000738.2-1942s21c1
Sequence:CCGGACTTTCCAGACTTCGCTATTCCTCGAGGAATAGCGAAGTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-562s21c1
Sequence:CCGGCGGAGCTCAAGACAGTCAATACTCGAGTATTGACTGTCTTGAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-1374s21c1
Sequence:CCGGACAGTCAAGAGGCCGACTAAGCTCGAGCTTAGTCGGCCTCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-1650s1c1
Sequence:CCGGTGCTACGCACTCTGCAACAAACTCGAGTTTGTTGCAGAGTGCGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-644s1c1
Sequence:CCGGCTATACCACGTACCTGCTCATCTCGAGATGAGCAGGTACGTGGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-533s1c1
Sequence:CCGGGCTGGTACTCATCTCTTTCAACTCGAGTTGAAAGAGATGAGTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-1386s1c1
Sequence:CCGGCCGACTAAGAAAGGGCGTGATCTCGAGATCACGCCCTTTCTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000738.2-2406s1c1
Sequence:CCGGGCTTGGCTAGTCACATATCAACTCGAGTTGATATGTGACTAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000738
CHRM1 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-1651s21c1
Sequence:CCGGGCTACGCACTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000738.2-1942s21c1
Sequence:CCGGACTTTCCAGACTTCGCTATTCCTCGAGGAATAGCGAAGTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-562s21c1
Sequence:CCGGCGGAGCTCAAGACAGTCAATACTCGAGTATTGACTGTCTTGAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-1374s21c1
Sequence:CCGGACAGTCAAGAGGCCGACTAAGCTCGAGCTTAGTCGGCCTCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-1650s1c1
Sequence:CCGGTGCTACGCACTCTGCAACAAACTCGAGTTTGTTGCAGAGTGCGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-644s1c1
Sequence:CCGGCTATACCACGTACCTGCTCATCTCGAGATGAGCAGGTACGTGGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-533s1c1
Sequence:CCGGGCTGGTACTCATCTCTTTCAACTCGAGTTGAAAGAGATGAGTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-1386s1c1
Sequence:CCGGCCGACTAAGAAAGGGCGTGATCTCGAGATCACGCCCTTTCTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000738.2-2406s1c1
Sequence:CCGGGCTTGGCTAGTCACATATCAACTCGAGTTGATATGTGACTAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000738
CHRM1 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-1651s21c1
Sequence:CCGGGCTACGCACTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000738.2-1942s21c1
Sequence:CCGGACTTTCCAGACTTCGCTATTCCTCGAGGAATAGCGAAGTCTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-562s21c1
Sequence:CCGGCGGAGCTCAAGACAGTCAATACTCGAGTATTGACTGTCTTGAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000738.2-1374s21c1
Sequence:CCGGACAGTCAAGAGGCCGACTAAGCTCGAGCTTAGTCGGCCTCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-1650s1c1
Sequence:CCGGTGCTACGCACTCTGCAACAAACTCGAGTTTGTTGCAGAGTGCGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-644s1c1
Sequence:CCGGCTATACCACGTACCTGCTCATCTCGAGATGAGCAGGTACGTGGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-533s1c1
Sequence:CCGGGCTGGTACTCATCTCTTTCAACTCGAGTTGAAAGAGATGAGTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000738.2-1386s1c1
Sequence:CCGGCCGACTAAGAAAGGGCGTGATCTCGAGATCACGCCCTTTCTTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000738.2-2406s1c1
Sequence:CCGGGCTTGGCTAGTCACATATCAACTCGAGTTGATATGTGACTAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007698
CHRM1 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1428s21c1
Sequence:CCGGATCAAGATGCCTATGGTAGATCTCGAGATCTACCATAGGCATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1139s21c1
Sequence:CCGGTACGCTGTACTGGCGCATCTACTCGAGTAGATGCGCCAGTACAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1774s21c1
Sequence:CCGGGCTACGCACTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007698.3-5832s21c1
Sequence:CCGGCGCCACCTGCTGGCAATTTAACTCGAGTTAAATTGCCAGCAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-391s1c1
Sequence:CCGGTGATCTCATCATTGGCACTTTCTCGAGAAAGTGCCAATGATGAGATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-415s1c1
Sequence:CCGGCATGAACCTCTATACCACATACTCGAGTATGTGGTATAGAGGTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-1353s1c1
Sequence:CCGGGCAAGGACTGTGTTCCAGAAACTCGAGTTTCTGGAACACAGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-250s1c1
Sequence:CCGGGCAAGTGGCATTCATCGGGATCTCGAGATCCCGATGAATGCCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-1336s1c1
Sequence:CCGGGCTGGTGTCTACATTCTGCAACTCGAGTTGCAGAATGTAGACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007698
CHRM1 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1428s21c1
Sequence:CCGGATCAAGATGCCTATGGTAGATCTCGAGATCTACCATAGGCATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1139s21c1
Sequence:CCGGTACGCTGTACTGGCGCATCTACTCGAGTAGATGCGCCAGTACAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1774s21c1
Sequence:CCGGGCTACGCACTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007698.3-5832s21c1
Sequence:CCGGCGCCACCTGCTGGCAATTTAACTCGAGTTAAATTGCCAGCAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-391s1c1
Sequence:CCGGTGATCTCATCATTGGCACTTTCTCGAGAAAGTGCCAATGATGAGATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-415s1c1
Sequence:CCGGCATGAACCTCTATACCACATACTCGAGTATGTGGTATAGAGGTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-1353s1c1
Sequence:CCGGGCAAGGACTGTGTTCCAGAAACTCGAGTTTCTGGAACACAGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-250s1c1
Sequence:CCGGGCAAGTGGCATTCATCGGGATCTCGAGATCCCGATGAATGCCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-1336s1c1
Sequence:CCGGGCTGGTGTCTACATTCTGCAACTCGAGTTGCAGAATGTAGACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007698
CHRM1 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1428s21c1
Sequence:CCGGATCAAGATGCCTATGGTAGATCTCGAGATCTACCATAGGCATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1139s21c1
Sequence:CCGGTACGCTGTACTGGCGCATCTACTCGAGTAGATGCGCCAGTACAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007698.3-1774s21c1
Sequence:CCGGGCTACGCACTCTGCAACAAAGCTCGAGCTTTGTTGCAGAGTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007698.3-5832s21c1
Sequence:CCGGCGCCACCTGCTGGCAATTTAACTCGAGTTAAATTGCCAGCAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-391s1c1
Sequence:CCGGTGATCTCATCATTGGCACTTTCTCGAGAAAGTGCCAATGATGAGATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-415s1c1
Sequence:CCGGCATGAACCTCTATACCACATACTCGAGTATGTGGTATAGAGGTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-1353s1c1
Sequence:CCGGGCAAGGACTGTGTTCCAGAAACTCGAGTTTCTGGAACACAGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-250s1c1
Sequence:CCGGGCAAGTGGCATTCATCGGGATCTCGAGATCCCGATGAATGCCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007698.2-1336s1c1
Sequence:CCGGGCTGGTGTCTACATTCTGCAACTCGAGTTGCAGAATGTAGACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks