EMAIL THIS PAGE TO A FRIEND

CHRM2

cholinergic receptor, muscarinic 2

221 Gene Product Result for
Synonyms: HM2
UniProtKB ID: P08172, Q4VBK6, Q9P1X9
Gene ID:
Human(1129) Summary: The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(243764) cholinergic receptor, muscarinic 2, cardiac
Rat(81645) cholinergic receptor, muscarinic 2
sheep(101102897) cholinergic receptor, muscarinic 2
sheep(100628317) cholinergic receptor, muscarinic 2
Domestic Rabbit(100342878) cholinergic receptor, muscarinic 2
domestic guinea pig(100715343) cholinergic receptor, muscarinic 2
naked mole-rat(101714286) cholinergic receptor, muscarinic 2
chicken(418126) cholinergic receptor, muscarinic 2
domestic cat(101099790) cholinergic receptor, muscarinic 2
cow(522170) cholinergic receptor, muscarinic 2
dog(403858) cholinergic receptor, muscarinic 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S1875 (−)-Scopolamine hydrobromide trihydrate ≥98% (HPLC), powder human pricing
S8502 (−)-Scopolamine methyl bromide ≥98% (HPLC), powder human pricing
S7882 (−)-Scopolamine N-butyl bromide ≥98% (TLC), powder human pricing
S2250 (−)Scopolamine methyl nitrate human pricing
A6883 Atropine methyl bromide ≥99% (TLC), powder human pricing
A0257 Atropine sulfate salt monohydrate ≥97% (TLC), crystalline human pricing
D7909 Dicyclomine hydrochloride ≥99% (TLC), powder human pricing
T1516 DL-Trihexyphenidyl hydrochloride solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
G8134 Gallamine triethiodide ≥98% (TLC), powder, muscarinic receptor antagonist human pricing
I1637 Ipratropium bromide monohydrate ≥98% (TLC), powder human pricing
M105 Methoctramine hydrate ≥97% (NMR), solid human pricing
O2881 Oxybutynin chloride ≥98% (TLC), powder human pricing
P8891 Propantheline bromide ≥97% (TLC), powder human pricing
A0132 Atropine ≥99% (TLC), powder human, mouse, rat pricing
A2468 Atropine meets USP testing specifications human, mouse, rat pricing
C4382 Carbamoylcholine chloride ≥98% (titration), crystalline human, mouse, rat pricing
C2409 Carbamoylcholine chloride 99% human, mouse, rat pricing
E8375 Eserine human, mouse, rat pricing
45710 Eserine ≥98.0% (N) human, mouse, rat pricing
P127 (+)-Pentazocine solid human, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline human, rat pricing
C7041 McN-A-343 ≥98% (TLC) human, rat pricing
C003 (R)-(−)-3-Quinuclidinyl benzilate rat pricing
P206 Philanthotoxin 343 tris(trifluoroacetate) salt solid rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8404 Amitriptyline hydrochloride ≥98% (TLC), powder human pricing
G9541 G Protein Antagonist ≥90% (HPLC) human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
A138 Aminobenztropine solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_145245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_145245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_145245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000739 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120771 MISSION® esiRNA esiRNA human CHRM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000739 Rosetta Predictions human pricing
NM_001006626 Rosetta Predictions human pricing
NM_001006627 Rosetta Predictions human pricing
NM_001006628 Rosetta Predictions human pricing
NM_001006629 Rosetta Predictions human pricing
NM_001006630 Rosetta Predictions human pricing
NM_001006631 Rosetta Predictions human pricing
NM_001006632 Rosetta Predictions human pricing
NM_031016 Rosetta Predictions rat pricing
NM_203491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199367 predicted 1539
2 SASI_Hs01_00199368 predicted 724
3 SASI_Hs01_00199369 predicted 1861
4 SASI_Hs01_00199370 predicted 1639
5 SASI_Hs01_00199371 predicted 958
6 SASI_Hs01_00199372 predicted 1080
7 SASI_Hs01_00199373 predicted 1724
8 SASI_Hs01_00199374 predicted 983
9 SASI_Hs01_00199375 predicted 1826
10 SASI_Hs01_00199376 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098977 predicted 1574
2 SASI_Hs01_00098978 predicted 765
3 SASI_Hs01_00098979 predicted 1901
4 SASI_Hs01_00098980 predicted 1683
5 SASI_Hs01_00098981 predicted 996
6 SASI_Hs01_00098982 predicted 1126
7 SASI_Hs01_00098983 predicted 1771
8 SASI_Hs01_00098984 predicted 1024
9 SASI_Hs01_00098985 predicted 1866
10 SASI_Hs01_00098986 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120282 predicted 1716
2 SASI_Hs01_00120283 predicted 906
3 SASI_Hs01_00120284 predicted 2037
4 SASI_Hs01_00120285 predicted 1814
5 SASI_Hs01_00120286 predicted 1129
6 SASI_Hs01_00120287 predicted 1253
7 SASI_Hs01_00120288 predicted 1903
8 SASI_Hs01_00120289 predicted 1161
9 SASI_Hs01_00120290 predicted 1997
10 SASI_Hs01_00120291 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020621 predicted 1463
2 SASI_Hs01_00020622 predicted 655
3 SASI_Hs01_00020623 predicted 1791
4 SASI_Hs01_00020624 predicted 1565
5 SASI_Hs01_00020625 predicted 880
6 SASI_Hs01_00020626 predicted 1007
7 SASI_Hs01_00020627 predicted 1652
8 SASI_Hs01_00020628 predicted 909
9 SASI_Hs01_00020629 predicted 1748
10 SASI_Hs01_00020630 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090639 predicted 1395
2 SASI_Hs01_00090640 predicted 580
3 SASI_Hs01_00090641 predicted 1723
4 SASI_Hs01_00090642 predicted 1494
5 SASI_Hs01_00090643 predicted 820
6 SASI_Hs01_00090644 predicted 939
7 SASI_Hs01_00090645 predicted 1590
8 SASI_Hs01_00090646 predicted 841
9 SASI_Hs01_00090647 predicted 1684
10 SASI_Hs01_00090648 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038543 predicted 1793
2 SASI_Hs01_00038544 predicted 976
3 SASI_Hs01_00038545 predicted 2113
4 SASI_Hs01_00038546 predicted 1896
5 SASI_Hs01_00038547 predicted 1209
6 SASI_Hs01_00038548 predicted 1334
7 SASI_Hs01_00038549 predicted 1983
8 SASI_Hs01_00038550 predicted 1237
9 SASI_Hs01_00038551 predicted 2079
10 SASI_Hs01_00038552 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107763 predicted 1477
2 SASI_Hs01_00107764 predicted 667
3 SASI_Hs01_00107765 predicted 1809
4 SASI_Hs01_00107766 predicted 1582
5 SASI_Hs01_00107767 predicted 905
6 SASI_Hs01_00107768 predicted 1024
7 SASI_Hs01_00107769 predicted 1677
8 SASI_Hs01_00107770 predicted 931
9 SASI_Hs01_00107771 predicted 1768
10 SASI_Hs01_00107772 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239522 predicted 1456
2 SASI_Hs01_00239523 predicted 649
3 SASI_Hs01_00239524 predicted 1786
4 SASI_Hs01_00239525 predicted 1564
5 SASI_Hs01_00239526 predicted 885
6 SASI_Hs01_00239527 predicted 1000
7 SASI_Hs01_00239528 predicted 1652
8 SASI_Hs01_00239529 predicted 907
9 SASI_Hs01_00239530 predicted 1743
10 SASI_Hs01_00239531 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094787 predicted 1393
2 SASI_Rn01_00094788 predicted 497
3 SASI_Rn01_00094789 predicted 918
4 SASI_Rn02_00264209 predicted 1340
5 SASI_Rn01_00094790 predicted 1808
6 SASI_Rn01_00094793 predicted 1344
7 SASI_Rn01_00094794 predicted 1615
8 SASI_Rn01_00094795 predicted 787
9 SASI_Rn01_00094796 predicted 493
10 SASI_Rn02_00264210 predicted 670
11 SASI_Rn01_00094791 predicted 1760
12 SASI_Rn01_00094792 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084525 predicted 468
2 SASI_Mm01_00084526 predicted 881
3 SASI_Mm01_00084527 predicted 877
4 SASI_Mm01_00084528 predicted 377
5 SASI_Mm01_00084529 predicted 231
6 SASI_Mm01_00084530 predicted 360
7 SASI_Mm01_00084531 predicted 938
8 SASI_Mm01_00084532 predicted 224
9 SASI_Mm01_00084533 predicted 712
10 SASI_Mm01_00084534 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_145245
CHRM2 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-801s1c1
Sequence:CCGGCGTTATGAATCTTCTCATCATCTCGAGATGATGAGAAGATTCATAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-627s1c1
Sequence:CCGGCCACCTTCAGACTGTCAACAACTCGAGTTGTTGACAGTCTGAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-1169s1c1
Sequence:CCGGCGAGTCTAGTGCAAGGAAGAACTCGAGTTCTTCCTTGCACTAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-577s1c1
Sequence:CCGGGTGACCATCATTGGGAACATTCTCGAGAATGTTCCCAATGATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-1543s1c1
Sequence:CCGGCAGAACATTGTAGCCCGCAAACTCGAGTTTGCGGGCTACAATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_145245
CHRM2 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-801s1c1
Sequence:CCGGCGTTATGAATCTTCTCATCATCTCGAGATGATGAGAAGATTCATAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-627s1c1
Sequence:CCGGCCACCTTCAGACTGTCAACAACTCGAGTTGTTGACAGTCTGAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-1169s1c1
Sequence:CCGGCGAGTCTAGTGCAAGGAAGAACTCGAGTTCTTCCTTGCACTAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-577s1c1
Sequence:CCGGGTGACCATCATTGGGAACATTCTCGAGAATGTTCCCAATGATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-1543s1c1
Sequence:CCGGCAGAACATTGTAGCCCGCAAACTCGAGTTTGCGGGCTACAATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_145245
CHRM2 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-801s1c1
Sequence:CCGGCGTTATGAATCTTCTCATCATCTCGAGATGATGAGAAGATTCATAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-627s1c1
Sequence:CCGGCCACCTTCAGACTGTCAACAACTCGAGTTGTTGACAGTCTGAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-1169s1c1
Sequence:CCGGCGAGTCTAGTGCAAGGAAGAACTCGAGTTCTTCCTTGCACTAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-577s1c1
Sequence:CCGGGTGACCATCATTGGGAACATTCTCGAGAATGTTCCCAATGATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145245.2-1543s1c1
Sequence:CCGGCAGAACATTGTAGCCCGCAAACTCGAGTTTGCGGGCTACAATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000739
CHRM2 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-1155s1c1
Sequence:CCGGCACCAGGACAATCTTGGCTATCTCGAGATAGCCAAGATTGTCCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-1049s1c1
Sequence:CCGGCAGGTCAGAATGGAGATGAAACTCGAGTTTCATCTCCATTCTGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-96s1c1
Sequence:CCGGCCTCAGTTTGGTGACCATTATCTCGAGATAATGGTCACCAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-202s1c1
Sequence:CCGGGCTGACCTTATCATAGGTGTTCTCGAGAACACCTATGATAAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-569s1c1
Sequence:CCGGCGGCTATTGCAGCCTTCTATTCTCGAGAATAGAAGGCTGCAATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-467s21c1
Sequence:CCGGCCTCAGTTTGGTGACCATTATCTCGAGATAATGGTCACCAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000739.2-2268s21c1
Sequence:CCGGTCCGGAGTGTTAAGCATATTTCTCGAGAAATATGCTTAACACTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-1420s21c1
Sequence:CCGGCAGGTCAGAATGGAGATGAAACTCGAGTTTCATCTCCATTCTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-1526s21c1
Sequence:CCGGCACCAGGACAATCTTGGCTATCTCGAGATAGCCAAGATTGTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-408s21c1
Sequence:CCGGGCTCTTACAAGTCCTTATAAGCTCGAGCTTATAAGGACTTGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000739
CHRM2 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-1155s1c1
Sequence:CCGGCACCAGGACAATCTTGGCTATCTCGAGATAGCCAAGATTGTCCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-1049s1c1
Sequence:CCGGCAGGTCAGAATGGAGATGAAACTCGAGTTTCATCTCCATTCTGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-96s1c1
Sequence:CCGGCCTCAGTTTGGTGACCATTATCTCGAGATAATGGTCACCAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-202s1c1
Sequence:CCGGGCTGACCTTATCATAGGTGTTCTCGAGAACACCTATGATAAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-569s1c1
Sequence:CCGGCGGCTATTGCAGCCTTCTATTCTCGAGAATAGAAGGCTGCAATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-467s21c1
Sequence:CCGGCCTCAGTTTGGTGACCATTATCTCGAGATAATGGTCACCAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000739.2-2268s21c1
Sequence:CCGGTCCGGAGTGTTAAGCATATTTCTCGAGAAATATGCTTAACACTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-1420s21c1
Sequence:CCGGCAGGTCAGAATGGAGATGAAACTCGAGTTTCATCTCCATTCTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-1526s21c1
Sequence:CCGGCACCAGGACAATCTTGGCTATCTCGAGATAGCCAAGATTGTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-408s21c1
Sequence:CCGGGCTCTTACAAGTCCTTATAAGCTCGAGCTTATAAGGACTTGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000739
CHRM2 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-1155s1c1
Sequence:CCGGCACCAGGACAATCTTGGCTATCTCGAGATAGCCAAGATTGTCCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-1049s1c1
Sequence:CCGGCAGGTCAGAATGGAGATGAAACTCGAGTTTCATCTCCATTCTGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-96s1c1
Sequence:CCGGCCTCAGTTTGGTGACCATTATCTCGAGATAATGGTCACCAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-202s1c1
Sequence:CCGGGCTGACCTTATCATAGGTGTTCTCGAGAACACCTATGATAAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000739.1-569s1c1
Sequence:CCGGCGGCTATTGCAGCCTTCTATTCTCGAGAATAGAAGGCTGCAATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-467s21c1
Sequence:CCGGCCTCAGTTTGGTGACCATTATCTCGAGATAATGGTCACCAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000739.2-2268s21c1
Sequence:CCGGTCCGGAGTGTTAAGCATATTTCTCGAGAAATATGCTTAACACTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-1420s21c1
Sequence:CCGGCAGGTCAGAATGGAGATGAAACTCGAGTTTCATCTCCATTCTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-1526s21c1
Sequence:CCGGCACCAGGACAATCTTGGCTATCTCGAGATAGCCAAGATTGTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000739.2-408s21c1
Sequence:CCGGGCTCTTACAAGTCCTTATAAGCTCGAGCTTATAAGGACTTGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks