EMAIL THIS PAGE TO A FRIEND

CHRM3

cholinergic receptor, muscarinic 3

137 Gene Product Result for
Synonyms: EGBRS HM3
UniProtKB ID: P20309, Q0VAJ8, Q4QRI3, Q5VXY2, Q9HB60
Gene ID:
Human(1131) Summary: The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. [provided by RefSeq, Jul 2008]
Mouse(12671) cholinergic receptor, muscarinic 3, cardiac
Rat(24260) cholinergic receptor, muscarinic 3
chicken(396364) cholinergic receptor, muscarinic 3
dog(403827) cholinergic receptor, muscarinic 3
Horse(100056633) cholinergic receptor, muscarinic 3
cow(281685) cholinergic receptor, muscarinic 3
domestic cat(101100919) cholinergic receptor, muscarinic 3
domestic guinea pig(100379235) cholinergic receptor, muscarinic 3, cardiac
sheep(443189) cholinergic receptor, muscarinic 3
Domestic Rabbit(100355313) cholinergic receptor, muscarinic 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S1875 (−)-Scopolamine hydrobromide trihydrate ≥98% (HPLC), powder human pricing
S8502 (−)-Scopolamine methyl bromide ≥98% (HPLC), powder human pricing
S7882 (−)-Scopolamine N-butyl bromide ≥98% (TLC), powder human pricing
S2250 (−)Scopolamine methyl nitrate human pricing
A6883 Atropine methyl bromide ≥99% (TLC), powder human pricing
A0257 Atropine sulfate salt monohydrate ≥97% (TLC), crystalline human pricing
D7909 Dicyclomine hydrochloride ≥99% (TLC), powder human pricing
T1516 DL-Trihexyphenidyl hydrochloride solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
G8134 Gallamine triethiodide ≥98% (TLC), powder, muscarinic receptor antagonist human pricing
I1637 Ipratropium bromide monohydrate ≥98% (TLC), powder human pricing
O2881 Oxybutynin chloride ≥98% (TLC), powder human pricing
H127 p-Fluorohexahydro-sila-difenidol hydrochloride powder, ≥98% (HPLC) human pricing
P8891 Propantheline bromide ≥97% (TLC), powder human pricing
A0132 Atropine ≥99% (TLC), powder human, mouse, rat pricing
A2468 Atropine meets USP testing specifications human, mouse, rat pricing
C4382 Carbamoylcholine chloride ≥98% (titration), crystalline human, mouse, rat pricing
C2409 Carbamoylcholine chloride 99% human, mouse, rat pricing
51330 Harmaline human, rat pricing
C7041 McN-A-343 ≥98% (TLC) human, rat pricing
C003 (R)-(−)-3-Quinuclidinyl benzilate rat pricing
P206 Philanthotoxin 343 tris(trifluoroacetate) salt solid rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8404 Amitriptyline hydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
A138 Aminobenztropine solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000740 Rosetta Predictions human pricing
NM_012527 Rosetta Predictions rat pricing
NM_033269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112284 predicted 1839
2 SASI_Hs01_00112285 predicted 1047
3 SASI_Hs01_00112286 predicted 1396
4 SASI_Hs01_00112287 predicted 1381
5 SASI_Hs01_00112288 predicted 876
6 SASI_Hs01_00112289 predicted 2101
7 SASI_Hs01_00112290 predicted 2176
8 SASI_Hs01_00112291 predicted 2082
9 SASI_Hs01_00112292 predicted 1860
10 SASI_Hs01_00112293 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041487 predicted 1703
2 SASI_Rn01_00041489 predicted 929
3 SASI_Rn01_00041490 predicted 1418
4 SASI_Rn01_00041491 predicted 1606
5 SASI_Rn01_00041492 predicted 1171
6 SASI_Rn01_00041493 predicted 1116
7 SASI_Rn01_00041494 predicted 410
8 SASI_Rn01_00041495 predicted 1438
9 SASI_Rn01_00041496 predicted 1233
10 SASI_Rn02_00259602 predicted 415
11 SASI_Rn01_00041488 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063802 predicted 1983
2 SASI_Mm01_00063803 predicted 2340
3 SASI_Mm01_00063804 predicted 1914
4 SASI_Mm01_00063805 predicted 1562
5 SASI_Mm01_00063806 predicted 1978
6 SASI_Mm01_00063807 predicted 1965
7 SASI_Mm01_00063808 predicted 1391
8 SASI_Mm01_00063809 predicted 1300
9 SASI_Mm01_00063810 predicted 2189
10 SASI_Mm01_00063811 predicted 2452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000740
CHRM3 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-2500s21c1
Sequence:CCGGAGCAGAGACAGTCGGTCATTTCTCGAGAAATGACCGACTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-1507s21c1
Sequence:CCGGCTGTCACCATTATGACTATTTCTCGAGAAATAGTCATAATGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-1030s21c1
Sequence:CCGGTCGGCAACATCCTGGTAATTGCTCGAGCAATTACCAGGATGTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-727s1c1
Sequence:CCGGCCTGTCACCATTATGACTATTCTCGAGAATAGTCATAATGGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-261s1c1
Sequence:CCGGCCTGGTAATTGTGTCATTTAACTCGAGTTAAATGACACAATTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-1409s1c1
Sequence:CCGGAGACCAGAAGTCAGATCACTACTCGAGTAGTGATCTGACTTCTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-891s1c1
Sequence:CCGGGCAAAGCATGAAACGCTCCAACTCGAGTTGGAGCGTTTCATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-528s1c1
Sequence:CCGGCCGAGCCAAACGAACAACAAACTCGAGTTTGTTGTTCGTTTGGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000740
CHRM3 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-2500s21c1
Sequence:CCGGAGCAGAGACAGTCGGTCATTTCTCGAGAAATGACCGACTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-1507s21c1
Sequence:CCGGCTGTCACCATTATGACTATTTCTCGAGAAATAGTCATAATGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-1030s21c1
Sequence:CCGGTCGGCAACATCCTGGTAATTGCTCGAGCAATTACCAGGATGTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-727s1c1
Sequence:CCGGCCTGTCACCATTATGACTATTCTCGAGAATAGTCATAATGGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-261s1c1
Sequence:CCGGCCTGGTAATTGTGTCATTTAACTCGAGTTAAATGACACAATTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-1409s1c1
Sequence:CCGGAGACCAGAAGTCAGATCACTACTCGAGTAGTGATCTGACTTCTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-891s1c1
Sequence:CCGGGCAAAGCATGAAACGCTCCAACTCGAGTTGGAGCGTTTCATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-528s1c1
Sequence:CCGGCCGAGCCAAACGAACAACAAACTCGAGTTTGTTGTTCGTTTGGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000740
CHRM3 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-2500s21c1
Sequence:CCGGAGCAGAGACAGTCGGTCATTTCTCGAGAAATGACCGACTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-1507s21c1
Sequence:CCGGCTGTCACCATTATGACTATTTCTCGAGAAATAGTCATAATGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000740.2-1030s21c1
Sequence:CCGGTCGGCAACATCCTGGTAATTGCTCGAGCAATTACCAGGATGTTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-727s1c1
Sequence:CCGGCCTGTCACCATTATGACTATTCTCGAGAATAGTCATAATGGTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-261s1c1
Sequence:CCGGCCTGGTAATTGTGTCATTTAACTCGAGTTAAATGACACAATTACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-1409s1c1
Sequence:CCGGAGACCAGAAGTCAGATCACTACTCGAGTAGTGATCTGACTTCTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-891s1c1
Sequence:CCGGGCAAAGCATGAAACGCTCCAACTCGAGTTGGAGCGTTTCATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000740.1-528s1c1
Sequence:CCGGCCGAGCCAAACGAACAACAAACTCGAGTTTGTTGTTCGTTTGGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033269
CHRM3 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-2380s1c1
Sequence:CCGGCTATATCAACAGCACCGTGAACTCGAGTTCACGGTGCTGTTGATATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-918s1c1
Sequence:CCGGCCTCTGGGAATTTCTCCTCAACTCGAGTTGAGGAGAAATTCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1052s1c1
Sequence:CCGGGTGGCATTTAAGGTCAACAAACTCGAGTTTGTTGACCTTAAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1435s1c1
Sequence:CCGGCGGAGAATGTTTCATTCAGTTCTCGAGAACTGAATGAAACATTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1207s1c1
Sequence:CCGGCCTCTGGCTTTCCATTGACTACTCGAGTAGTCAATGGAAAGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033269
CHRM3 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-2380s1c1
Sequence:CCGGCTATATCAACAGCACCGTGAACTCGAGTTCACGGTGCTGTTGATATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-918s1c1
Sequence:CCGGCCTCTGGGAATTTCTCCTCAACTCGAGTTGAGGAGAAATTCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1052s1c1
Sequence:CCGGGTGGCATTTAAGGTCAACAAACTCGAGTTTGTTGACCTTAAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1435s1c1
Sequence:CCGGCGGAGAATGTTTCATTCAGTTCTCGAGAACTGAATGAAACATTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1207s1c1
Sequence:CCGGCCTCTGGCTTTCCATTGACTACTCGAGTAGTCAATGGAAAGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033269
CHRM3 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-2380s1c1
Sequence:CCGGCTATATCAACAGCACCGTGAACTCGAGTTCACGGTGCTGTTGATATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-918s1c1
Sequence:CCGGCCTCTGGGAATTTCTCCTCAACTCGAGTTGAGGAGAAATTCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1052s1c1
Sequence:CCGGGTGGCATTTAAGGTCAACAAACTCGAGTTTGTTGACCTTAAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1435s1c1
Sequence:CCGGCGGAGAATGTTTCATTCAGTTCTCGAGAACTGAATGAAACATTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033269.2-1207s1c1
Sequence:CCGGCCTCTGGCTTTCCATTGACTACTCGAGTAGTCAATGGAAAGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks