EMAIL THIS PAGE TO A FRIEND

CHRM4

cholinergic receptor, muscarinic 4

88 Gene Product Result for
Synonyms: HM4 M4R
UniProtKB ID: P08173, B2RPP4, Q0VD60, Q4VBK7
Gene ID:
Human(1132) Summary: The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, mouse studies link its function to adenylyl cyclase inhibition. [provided by RefSeq, Jul 2008]
Mouse(12672) cholinergic receptor, muscarinic 4
Rat(25111) cholinergic receptor, muscarinic 4
chicken(423195) cholinergic receptor, muscarinic 4
cow(512928) cholinergic receptor, muscarinic 4
domestic cat(101088360) cholinergic receptor, muscarinic 4
dog(611314) cholinergic receptor, muscarinic 4
sheep(101114554) cholinergic receptor, muscarinic 4
Domestic Rabbit(100008791) cholinergic receptor, muscarinic 4
domestic guinea pig(100714736) cholinergic receptor, muscarinic 4
naked mole-rat(101726411) cholinergic receptor, muscarinic 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500250 Anti-CHRM4 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
SAB2900509 Anti-CHRM4 antibody produced in rabbit affinity isolated antibody pig, bovine, human, rat, hamster, horse, mouse, guinea pig
immunohistochemistry pricing
SAB4300824 Anti-CHRM4 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S1875 (−)-Scopolamine hydrobromide trihydrate ≥98% (HPLC), powder human pricing
S8502 (−)-Scopolamine methyl bromide ≥98% (HPLC), powder human pricing
S7882 (−)-Scopolamine N-butyl bromide ≥98% (TLC), powder human pricing
S2250 (−)Scopolamine methyl nitrate human pricing
A6883 Atropine methyl bromide ≥99% (TLC), powder human pricing
A0257 Atropine sulfate salt monohydrate ≥97% (TLC), crystalline human pricing
B1390 Bisacodyl analytical standard, for drug analysis human pricing
D7909 Dicyclomine hydrochloride ≥99% (TLC), powder human pricing
T1516 DL-Trihexyphenidyl hydrochloride solid human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
G8134 Gallamine triethiodide ≥98% (TLC), powder, muscarinic receptor antagonist human pricing
I1637 Ipratropium bromide monohydrate ≥98% (TLC), powder human pricing
O2881 Oxybutynin chloride ≥98% (TLC), powder human pricing
P8891 Propantheline bromide ≥97% (TLC), powder human pricing
T9778 Tropicamide solid human pricing
A0132 Atropine ≥99% (TLC), powder human, mouse, rat pricing
A2468 Atropine meets USP testing specifications human, mouse, rat pricing
C4382 Carbamoylcholine chloride ≥98% (titration), crystalline human, mouse, rat pricing
C2409 Carbamoylcholine chloride 99% human, mouse, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
51330 Harmaline human, rat pricing
C7041 McN-A-343 ≥98% (TLC) human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8404 Amitriptyline hydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
A138 Aminobenztropine solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000741 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046221 MISSION® esiRNA esiRNA targeting mouse Chrm4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000741 Rosetta Predictions human pricing
NM_031547 Rosetta Predictions rat pricing
NM_007699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125634 predicted 437
2 SASI_Hs01_00125635 predicted 334
3 SASI_Hs01_00125636 predicted 1187
4 SASI_Hs01_00125637 predicted 1023
5 SASI_Hs01_00125638 predicted 1137
6 SASI_Hs01_00125639 predicted 576
7 SASI_Hs01_00125640 predicted 1201
8 SASI_Hs01_00125641 predicted 431
9 SASI_Hs01_00125642 predicted 1202
10 SASI_Hs01_00125643 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264721 predicted 1031
2 SASI_Rn02_00264722 predicted 1175
3 SASI_Rn02_00264723 predicted 912
4 SASI_Rn02_00264724 predicted 1240
5 SASI_Rn02_00264725 predicted 422
6 SASI_Rn02_00264726 predicted 1279
7 SASI_Rn02_00264727 predicted 599
8 SASI_Rn02_00264728 predicted 524
9 SASI_Rn02_00264729 predicted 315
10 SASI_Rn02_00264730 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088723 predicted 1039
2 SASI_Mm02_00312253 predicted 435
3 SASI_Mm01_00088724 predicted 1328
4 SASI_Mm02_00312254 predicted 920
5 SASI_Mm01_00088732 predicted 1254
6 SASI_Mm02_00312255 predicted 1211
7 SASI_Mm02_00312256 predicted 692
8 SASI_Mm02_00312257 predicted 329
9 SASI_Mm02_00312258 predicted 1296
10 SASI_Mm02_00312259 predicted 441
11 SASI_Mm01_00088725 predicted 342
12 SASI_Mm01_00088726 predicted 440
13 SASI_Mm01_00088727 predicted 1112
14 SASI_Mm01_00088728 predicted 387
15 SASI_Mm01_00088729 predicted 383
16 SASI_Mm01_00088730 predicted 1009
17 SASI_Mm01_00088731 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007699
CHRM4 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-859s1c1
Sequence:CCGGGCTGACAAGGACACTTCCAATCTCGAGATTGGAAGTGTCCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-328s1c1
Sequence:CCGGCTGGACTATGTGGTGAGCAATCTCGAGATTGCTCACCACATAGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-546s1c1
Sequence:CCGGCCAGTGCTTCATCCAGTTCTTCTCGAGAAGAACTGGATGAAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-180s1c1
Sequence:CCGGGCAGTTGCAGACAGTCAACAACTCGAGTTGTTGACTGTCTGCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-1019s1c1
Sequence:CCGGCCAAGATCCAAATTGTGACAACTCGAGTTGTCACAATTTGGATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007699.2-812s21c1
Sequence:CCGGATCATGACGGTGCTGTATATTCTCGAGAATATACAGCACCGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007699.2-928s21c1
Sequence:CCGGTCTGATGAAGCCGAGCATTAACTCGAGTTAATGCTCGGCTTCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007699
CHRM4 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-859s1c1
Sequence:CCGGGCTGACAAGGACACTTCCAATCTCGAGATTGGAAGTGTCCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-328s1c1
Sequence:CCGGCTGGACTATGTGGTGAGCAATCTCGAGATTGCTCACCACATAGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-546s1c1
Sequence:CCGGCCAGTGCTTCATCCAGTTCTTCTCGAGAAGAACTGGATGAAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-180s1c1
Sequence:CCGGGCAGTTGCAGACAGTCAACAACTCGAGTTGTTGACTGTCTGCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-1019s1c1
Sequence:CCGGCCAAGATCCAAATTGTGACAACTCGAGTTGTCACAATTTGGATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007699.2-812s21c1
Sequence:CCGGATCATGACGGTGCTGTATATTCTCGAGAATATACAGCACCGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007699.2-928s21c1
Sequence:CCGGTCTGATGAAGCCGAGCATTAACTCGAGTTAATGCTCGGCTTCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007699
CHRM4 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-859s1c1
Sequence:CCGGGCTGACAAGGACACTTCCAATCTCGAGATTGGAAGTGTCCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-328s1c1
Sequence:CCGGCTGGACTATGTGGTGAGCAATCTCGAGATTGCTCACCACATAGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-546s1c1
Sequence:CCGGCCAGTGCTTCATCCAGTTCTTCTCGAGAAGAACTGGATGAAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-180s1c1
Sequence:CCGGGCAGTTGCAGACAGTCAACAACTCGAGTTGTTGACTGTCTGCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007699.1-1019s1c1
Sequence:CCGGCCAAGATCCAAATTGTGACAACTCGAGTTGTCACAATTTGGATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007699.2-812s21c1
Sequence:CCGGATCATGACGGTGCTGTATATTCTCGAGAATATACAGCACCGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007699.2-928s21c1
Sequence:CCGGTCTGATGAAGCCGAGCATTAACTCGAGTTAATGCTCGGCTTCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000741
CHRM4 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-270s1c1
Sequence:CCGGCGTGTACATCATCAAGGGCTACTCGAGTAGCCCTTGATGATGTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-55s1c1
Sequence:CCGGGTCACGTCATCATCCCACAATCTCGAGATTGTGGGATGATGACGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-1182s1c1
Sequence:CCGGGCGCAAAGTGACACGAACGATCTCGAGATCGTTCGTGTCACTTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-223s1c1
Sequence:CCGGGCGTGTGCTGATCTCATCATACTCGAGTATGATGAGATCAGCACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-499s1c1
Sequence:CCGGGCCATCTTGTTCTGGCAGTTTCTCGAGAAACTGCCAGAACAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-500s21c1
Sequence:CCGGCCATCTTGTTCTGGCAGTTTGCTCGAGCAAACTGCCAGAACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-730s21c1
Sequence:CCGGTTCCTCAAGAGCCCACTAATGCTCGAGCATTAGTGGGCTCTTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-75s21c1
Sequence:CCGGTCGCTATGAGACGGTGGAAATCTCGAGATTTCCACCGTCTCATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-1013s21c1
Sequence:CCGGGATGGTCCAAGATCCAGATTGCTCGAGCAATCTGGATCTTGGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000741
CHRM4 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-270s1c1
Sequence:CCGGCGTGTACATCATCAAGGGCTACTCGAGTAGCCCTTGATGATGTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-55s1c1
Sequence:CCGGGTCACGTCATCATCCCACAATCTCGAGATTGTGGGATGATGACGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-1182s1c1
Sequence:CCGGGCGCAAAGTGACACGAACGATCTCGAGATCGTTCGTGTCACTTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-223s1c1
Sequence:CCGGGCGTGTGCTGATCTCATCATACTCGAGTATGATGAGATCAGCACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-499s1c1
Sequence:CCGGGCCATCTTGTTCTGGCAGTTTCTCGAGAAACTGCCAGAACAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-500s21c1
Sequence:CCGGCCATCTTGTTCTGGCAGTTTGCTCGAGCAAACTGCCAGAACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-730s21c1
Sequence:CCGGTTCCTCAAGAGCCCACTAATGCTCGAGCATTAGTGGGCTCTTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-75s21c1
Sequence:CCGGTCGCTATGAGACGGTGGAAATCTCGAGATTTCCACCGTCTCATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-1013s21c1
Sequence:CCGGGATGGTCCAAGATCCAGATTGCTCGAGCAATCTGGATCTTGGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000741
CHRM4 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-270s1c1
Sequence:CCGGCGTGTACATCATCAAGGGCTACTCGAGTAGCCCTTGATGATGTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-55s1c1
Sequence:CCGGGTCACGTCATCATCCCACAATCTCGAGATTGTGGGATGATGACGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-1182s1c1
Sequence:CCGGGCGCAAAGTGACACGAACGATCTCGAGATCGTTCGTGTCACTTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-223s1c1
Sequence:CCGGGCGTGTGCTGATCTCATCATACTCGAGTATGATGAGATCAGCACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000741.1-499s1c1
Sequence:CCGGGCCATCTTGTTCTGGCAGTTTCTCGAGAAACTGCCAGAACAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-500s21c1
Sequence:CCGGCCATCTTGTTCTGGCAGTTTGCTCGAGCAAACTGCCAGAACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-730s21c1
Sequence:CCGGTTCCTCAAGAGCCCACTAATGCTCGAGCATTAGTGGGCTCTTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-75s21c1
Sequence:CCGGTCGCTATGAGACGGTGGAAATCTCGAGATTTCCACCGTCTCATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000741.2-1013s21c1
Sequence:CCGGGATGGTCCAAGATCCAGATTGCTCGAGCAATCTGGATCTTGGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks