EMAIL THIS PAGE TO A FRIEND

CHRM5

cholinergic receptor, muscarinic 5

143 Gene Product Result for
Synonyms: HM5
UniProtKB ID: P08912, Q96RG7
Gene ID:
Human(1133) Summary: The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
Mouse(213788) cholinergic receptor, muscarinic 5
Rat(53949) cholinergic receptor, muscarinic 5
chicken(428881) cholinergic receptor, muscarinic 5
cow(281686) cholinergic receptor, muscarinic 5
Horse(100057856) cholinergic receptor, muscarinic 5
dog(487472) cholinergic receptor, muscarinic 5
domestic cat(101097246) cholinergic receptor, muscarinic 5
naked mole-rat(101719201) cholinergic receptor, muscarinic 5
domestic guinea pig(100379240) cholinergic receptor, muscarinic 5
sheep(101110766) cholinergic receptor, muscarinic 5
Domestic Rabbit(100342984) cholinergic receptor, muscarinic 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8404 Amitriptyline hydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
A138 Aminobenztropine solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_141500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_141500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_141500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130281 MISSION® esiRNA esiRNA human CHRM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012125 Rosetta Predictions human pricing
NM_017362 Rosetta Predictions rat pricing
NM_205783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246551 predicted 1596
2 SASI_Hs01_00246552 predicted 1442
3 SASI_Hs01_00246553 predicted 1488
4 SASI_Hs01_00246554 predicted 1180
5 SASI_Hs01_00246555 predicted 1699
6 SASI_Hs02_00343674 predicted 861
7 SASI_Hs01_00246556 predicted 1911
8 SASI_Hs01_00246557 predicted 924
9 SASI_Hs01_00246559 predicted 1541
10 SASI_Hs01_00246560 predicted 447
11 SASI_Hs01_00246558 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082850 predicted 2142
2 SASI_Rn01_00082851 predicted 1921
3 SASI_Rn01_00082852 predicted 1829
4 SASI_Rn01_00082853 predicted 978
5 SASI_Rn01_00082854 predicted 2332
6 SASI_Rn01_00082855 predicted 1628
7 SASI_Rn01_00082856 predicted 2252
8 SASI_Rn02_00261854 predicted 1319
9 SASI_Rn01_00082857 predicted 1090
10 SASI_Rn01_00082858 predicted 1801
11 SASI_Rn01_00082859 predicted 2465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081995 predicted 1171
2 SASI_Mm02_00351773 predicted 696
3 SASI_Mm01_00081996 predicted 1029
4 SASI_Mm01_00081997 predicted 822
5 SASI_Mm01_00081998 predicted 950
6 SASI_Mm01_00081999 predicted 219
7 SASI_Mm01_00082000 predicted 660
8 SASI_Mm01_00082001 predicted 346
9 SASI_Mm01_00082003 predicted 885
10 SASI_Mm01_00082004 predicted 1369
11 SASI_Mm01_00082002 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012125
CHRM5 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1908s21c1
Sequence:CCGGCTTCAACGAAAGGCCTCAATCCTCGAGGATTGAGGCCTTTCGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012125.3-2438s21c1
Sequence:CCGGGCAGCAATTGCTGACATATTACTCGAGTAATATGTCAGCAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1959s21c1
Sequence:CCGGAGAGAGTGGTCCTAGTCAAAGCTCGAGCTTTGACTAGGACCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1064s21c1
Sequence:CCGGATCACAAGACCCTTGACATATCTCGAGATATGTCAAGGGTCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012125.3-2732s21c1
Sequence:CCGGTTGTTAACGAGACTGATATTCCTCGAGGAATATCAGTCTCGTTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-2112s21c1
Sequence:CCGGATTGGTTGTGCTATGTCAATACTCGAGTATTGACATAGCACAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1836s21c1
Sequence:CCGGGGAACCAGGAGACCAACAATGCTCGAGCATTGTTGGTCTCCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-1583s1c1
Sequence:CCGGCCATCAAATGACCAAACGAAACTCGAGTTTCGTTTGGTCATTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-491s1c1
Sequence:CCGGCCAGCTCAAGACAGTTAACAACTCGAGTTGTTAACTGTCTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-1578s1c1
Sequence:CCGGCCCAGCCATCAAATGACCAAACTCGAGTTTGGTCATTTGATGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-359s1c1
Sequence:CCGGCCCAGTAAATCACCAGCCTTTCTCGAGAAAGGCTGGTGATTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012125.2-2521s1c1
Sequence:CCGGCCCTTTCATATCCAATGTCAACTCGAGTTGACATTGGATATGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012125
CHRM5 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1908s21c1
Sequence:CCGGCTTCAACGAAAGGCCTCAATCCTCGAGGATTGAGGCCTTTCGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012125.3-2438s21c1
Sequence:CCGGGCAGCAATTGCTGACATATTACTCGAGTAATATGTCAGCAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1959s21c1
Sequence:CCGGAGAGAGTGGTCCTAGTCAAAGCTCGAGCTTTGACTAGGACCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1064s21c1
Sequence:CCGGATCACAAGACCCTTGACATATCTCGAGATATGTCAAGGGTCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012125.3-2732s21c1
Sequence:CCGGTTGTTAACGAGACTGATATTCCTCGAGGAATATCAGTCTCGTTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-2112s21c1
Sequence:CCGGATTGGTTGTGCTATGTCAATACTCGAGTATTGACATAGCACAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1836s21c1
Sequence:CCGGGGAACCAGGAGACCAACAATGCTCGAGCATTGTTGGTCTCCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-1583s1c1
Sequence:CCGGCCATCAAATGACCAAACGAAACTCGAGTTTCGTTTGGTCATTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-491s1c1
Sequence:CCGGCCAGCTCAAGACAGTTAACAACTCGAGTTGTTAACTGTCTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-1578s1c1
Sequence:CCGGCCCAGCCATCAAATGACCAAACTCGAGTTTGGTCATTTGATGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-359s1c1
Sequence:CCGGCCCAGTAAATCACCAGCCTTTCTCGAGAAAGGCTGGTGATTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012125.2-2521s1c1
Sequence:CCGGCCCTTTCATATCCAATGTCAACTCGAGTTGACATTGGATATGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012125
CHRM5 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1908s21c1
Sequence:CCGGCTTCAACGAAAGGCCTCAATCCTCGAGGATTGAGGCCTTTCGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012125.3-2438s21c1
Sequence:CCGGGCAGCAATTGCTGACATATTACTCGAGTAATATGTCAGCAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1959s21c1
Sequence:CCGGAGAGAGTGGTCCTAGTCAAAGCTCGAGCTTTGACTAGGACCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1064s21c1
Sequence:CCGGATCACAAGACCCTTGACATATCTCGAGATATGTCAAGGGTCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012125.3-2732s21c1
Sequence:CCGGTTGTTAACGAGACTGATATTCCTCGAGGAATATCAGTCTCGTTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-2112s21c1
Sequence:CCGGATTGGTTGTGCTATGTCAATACTCGAGTATTGACATAGCACAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012125.3-1836s21c1
Sequence:CCGGGGAACCAGGAGACCAACAATGCTCGAGCATTGTTGGTCTCCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-1583s1c1
Sequence:CCGGCCATCAAATGACCAAACGAAACTCGAGTTTCGTTTGGTCATTTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-491s1c1
Sequence:CCGGCCAGCTCAAGACAGTTAACAACTCGAGTTGTTAACTGTCTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-1578s1c1
Sequence:CCGGCCCAGCCATCAAATGACCAAACTCGAGTTTGGTCATTTGATGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012125.2-359s1c1
Sequence:CCGGCCCAGTAAATCACCAGCCTTTCTCGAGAAAGGCTGGTGATTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012125.2-2521s1c1
Sequence:CCGGCCCTTTCATATCCAATGTCAACTCGAGTTGACATTGGATATGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_141500
CHRM5 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, muscarinic 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-79s1c1
Sequence:CCGGCTGTGGGAAGTCATTACTATTCTCGAGAATAGTAATGACTTCCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-1118s1c1
Sequence:CCGGGTCAGAAGTGTGTTGCCTATACTCGAGTATAGGCAACACACTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-1297s1c1
Sequence:CCGGGTCCTAGTCAAAGAGAGGAAACTCGAGTTTCCTCTCTTTGACTAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-45s1c1
Sequence:CCGGCCCAGTAAATCACCAGGCTTTCTCGAGAAAGCCTGGTGATTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-392s1c1
Sequence:CCGGCCATCACAAGACCACTGACATCTCGAGATGTCAGTGGTCTTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_141500
CHRM5 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, muscarinic 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-79s1c1
Sequence:CCGGCTGTGGGAAGTCATTACTATTCTCGAGAATAGTAATGACTTCCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-1118s1c1
Sequence:CCGGGTCAGAAGTGTGTTGCCTATACTCGAGTATAGGCAACACACTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-1297s1c1
Sequence:CCGGGTCCTAGTCAAAGAGAGGAAACTCGAGTTTCCTCTCTTTGACTAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-45s1c1
Sequence:CCGGCCCAGTAAATCACCAGGCTTTCTCGAGAAAGCCTGGTGATTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-392s1c1
Sequence:CCGGCCATCACAAGACCACTGACATCTCGAGATGTCAGTGGTCTTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_141500
CHRM5 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, muscarinic 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-79s1c1
Sequence:CCGGCTGTGGGAAGTCATTACTATTCTCGAGAATAGTAATGACTTCCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-1118s1c1
Sequence:CCGGGTCAGAAGTGTGTTGCCTATACTCGAGTATAGGCAACACACTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-1297s1c1
Sequence:CCGGGTCCTAGTCAAAGAGAGGAAACTCGAGTTTCCTCTCTTTGACTAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-45s1c1
Sequence:CCGGCCCAGTAAATCACCAGGCTTTCTCGAGAAAGCCTGGTGATTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141500.1-392s1c1
Sequence:CCGGCCATCACAAGACCACTGACATCTCGAGATGTCAGTGGTCTTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks