EMAIL THIS PAGE TO A FRIEND

CHRNA10

cholinergic receptor, nicotinic, alpha 10 (neuronal)

70 Gene Product Result for
UniProtKB ID: Q9GZZ6
Gene ID:
Mouse(504186) cholinergic receptor, nicotinic, alpha polypeptide 10
Rat(64574) cholinergic receptor, nicotinic, alpha 10 (neuronal)
naked mole-rat(101703453) cholinergic receptor, nicotinic, alpha 10 (neuronal)
domestic guinea pig(100715946) cholinergic receptor, nicotinic, alpha 10 (neuronal)
sheep(101123662) cholinergic receptor, nicotinic, alpha 10 (neuronal)
Domestic Rabbit(100344381) cholinergic receptor, nicotinic, alpha 10 (neuronal)
Zebrafish(556507) cholinergic receptor, nicotinic, alpha 10
dog(485215) cholinergic receptor, nicotinic, alpha 10
cow(539128) cholinergic receptor, nicotinic, alpha 10 (neuronal)
domestic cat(101097091) cholinergic receptor, nicotinic, alpha 10 (neuronal)
chicken(430628) cholinergic receptor, nicotinic, alpha 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303469 ANTI-CHRNA10 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502449 Anti-CHRNA10, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M9020 Mecamylamine hydrochloride human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020402 Rosetta Predictions human pricing
NM_022639 Rosetta Predictions rat pricing
NM_001081424 Rosetta Predictions mouse pricing
XM_989225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238015 predicted 573
2 SASI_Hs01_00238016 predicted 1011
3 SASI_Hs01_00238017 predicted 1259
4 SASI_Hs01_00238018 predicted 416
5 SASI_Hs01_00238019 predicted 263
6 SASI_Hs01_00238020 predicted 648
7 SASI_Hs01_00238021 predicted 1006
8 SASI_Hs01_00238022 predicted 259
9 SASI_Hs01_00238023 predicted 588
10 SASI_Hs01_00238024 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058815 predicted 968
2 SASI_Rn01_00058816 predicted 728
3 SASI_Rn01_00058817 predicted 1236
4 SASI_Rn01_00058818 predicted 1025
5 SASI_Rn02_00263425 predicted 204
6 SASI_Rn01_00058820 predicted 998
7 SASI_Rn01_00058821 predicted 1207
8 SASI_Rn01_00058822 predicted 242
9 SASI_Rn01_00058823 predicted 1004
10 SASI_Rn02_00263426 predicted 253
11 SASI_Rn01_00058814 predicted 945
12 SASI_Rn01_00058819 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298251 predicted 1352
2 SASI_Mm02_00298252 predicted 1654
3 SASI_Mm02_00298253 predicted 1557
4 SASI_Mm02_00298254 predicted 1273
5 SASI_Mm02_00298255 predicted 499
6 SASI_Mm02_00298256 predicted 1307
7 SASI_Mm02_00298257 predicted 481
8 SASI_Mm02_00298258 predicted 1336
9 SASI_Mm02_00298259 predicted 1369
10 SASI_Mm02_00298260 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217541 predicted 1361
2 SASI_Mm01_00217542 predicted 1661
3 SASI_Mm01_00217543 predicted 1558
4 SASI_Mm01_00217544 predicted 1278
5 SASI_Mm01_00217545 predicted 500
6 SASI_Mm01_00217546 predicted 1306
7 SASI_Mm01_00217547 predicted 481
8 SASI_Mm01_00217548 predicted 1344
9 SASI_Mm01_00217549 predicted 1372
10 SASI_Mm01_00217550 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020402
CHRNA10 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 10 (neuronal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020402.2-1729s21c1
Sequence:CCGGGGGAGCACATGGGTTATAATGCTCGAGCATTATAACCCATGTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020402.2-253s21c1
Sequence:CCGGGTGACACTGTCCCAGATCATCCTCGAGGATGATCTGGGACAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-411s1c1
Sequence:CCGGGCCAGACATCGTACTCTATAACTCGAGTTATAGAGTACGATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-1023s1c1
Sequence:CCGGCCTTATCATGAACCTGCATTACTCGAGTAATGCAGGTTCATGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-969s1c1
Sequence:CCGGGAAGTACTACATGGCCACTATCTCGAGATAGTGGCCATGTAGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-174s1c1
Sequence:CCGGCCGTGACCTCTTTGCCAACTACTCGAGTAGTTGGCAAAGAGGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-298s1c1
Sequence:CCGGCTGACCCTGTATCTGTGGATACTCGAGTATCCACAGATACAGGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020402
CHRNA10 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 10 (neuronal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020402.2-1729s21c1
Sequence:CCGGGGGAGCACATGGGTTATAATGCTCGAGCATTATAACCCATGTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020402.2-253s21c1
Sequence:CCGGGTGACACTGTCCCAGATCATCCTCGAGGATGATCTGGGACAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-411s1c1
Sequence:CCGGGCCAGACATCGTACTCTATAACTCGAGTTATAGAGTACGATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-1023s1c1
Sequence:CCGGCCTTATCATGAACCTGCATTACTCGAGTAATGCAGGTTCATGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-969s1c1
Sequence:CCGGGAAGTACTACATGGCCACTATCTCGAGATAGTGGCCATGTAGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-174s1c1
Sequence:CCGGCCGTGACCTCTTTGCCAACTACTCGAGTAGTTGGCAAAGAGGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-298s1c1
Sequence:CCGGCTGACCCTGTATCTGTGGATACTCGAGTATCCACAGATACAGGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020402
CHRNA10 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 10 (neuronal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020402.2-1729s21c1
Sequence:CCGGGGGAGCACATGGGTTATAATGCTCGAGCATTATAACCCATGTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020402.2-253s21c1
Sequence:CCGGGTGACACTGTCCCAGATCATCCTCGAGGATGATCTGGGACAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-411s1c1
Sequence:CCGGGCCAGACATCGTACTCTATAACTCGAGTTATAGAGTACGATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-1023s1c1
Sequence:CCGGCCTTATCATGAACCTGCATTACTCGAGTAATGCAGGTTCATGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-969s1c1
Sequence:CCGGGAAGTACTACATGGCCACTATCTCGAGATAGTGGCCATGTAGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-174s1c1
Sequence:CCGGCCGTGACCTCTTTGCCAACTACTCGAGTAGTTGGCAAAGAGGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020402.2-298s1c1
Sequence:CCGGCTGACCCTGTATCTGTGGATACTCGAGTATCCACAGATACAGGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081424
CHRNA10 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 10 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-689s21c1
Sequence:CCGGACGGTGACTTGGATGCAATTCCTCGAGGAATTGCATCCAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-732s21c1
Sequence:CCGGGCGACCAGACATCGTACTTTACTCGAGTAAAGTACGATGTCTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-981s21c1
Sequence:CCGGCTTCGTGGAGAACGTTGAATGCTCGAGCATTCAACGTTCTCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081424.1-2025s21c1
Sequence:CCGGAGCTGAGCAAGGTGATATAATCTCGAGATTATATCACCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-1284s21c1
Sequence:CCGGACTCATCGGAAAGTACTATATCTCGAGATATAGTACTTTCCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081424
CHRNA10 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 10 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-689s21c1
Sequence:CCGGACGGTGACTTGGATGCAATTCCTCGAGGAATTGCATCCAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-732s21c1
Sequence:CCGGGCGACCAGACATCGTACTTTACTCGAGTAAAGTACGATGTCTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-981s21c1
Sequence:CCGGCTTCGTGGAGAACGTTGAATGCTCGAGCATTCAACGTTCTCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081424.1-2025s21c1
Sequence:CCGGAGCTGAGCAAGGTGATATAATCTCGAGATTATATCACCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-1284s21c1
Sequence:CCGGACTCATCGGAAAGTACTATATCTCGAGATATAGTACTTTCCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081424
CHRNA10 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 10 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-689s21c1
Sequence:CCGGACGGTGACTTGGATGCAATTCCTCGAGGAATTGCATCCAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-732s21c1
Sequence:CCGGGCGACCAGACATCGTACTTTACTCGAGTAAAGTACGATGTCTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-981s21c1
Sequence:CCGGCTTCGTGGAGAACGTTGAATGCTCGAGCATTCAACGTTCTCCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081424.1-2025s21c1
Sequence:CCGGAGCTGAGCAAGGTGATATAATCTCGAGATTATATCACCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081424.1-1284s21c1
Sequence:CCGGACTCATCGGAAAGTACTATATCTCGAGATATAGTACTTTCCGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks