EMAIL THIS PAGE TO A FRIEND

CHRNA2

cholinergic receptor, nicotinic, alpha 2 (neuronal)

69 Gene Product Result for
UniProtKB ID: Q15822, A8KAX3, Q9HAQ3
Gene ID:
Human(1135) Summary: Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels formed by a pentameric arrangement of alpha and beta subunits to create distinct muscle and neuronal receptors. Neuronal receptors are found throughout the peripheral and central nervous system where they are involved in fast synaptic transmission. This gene encodes an alpha subunit that is widely expressed in the brain. The proposed structure for nAChR subunits is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. Mutations in this gene cause autosomal dominant nocturnal frontal lobe epilepsy type 4. Single nucleotide polymorphisms (SNPs) in this gene have been associated with nicotine dependence. [provided by RefSeq, Nov 2009]
Mouse(110902) cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
Rat(170945) cholinergic receptor, nicotinic, alpha 2 (neuronal)
chicken(395607) cholinergic receptor, nicotinic, alpha 2 (neuronal)
cow(531838) cholinergic receptor, nicotinic, alpha 2 (neuronal)
domestic cat(101092104) cholinergic receptor, nicotinic, alpha 2 (neuronal)
dog(486101) cholinergic receptor, nicotinic, alpha 2 (neuronal)
sheep(101107330) cholinergic receptor, nicotinic, alpha 2 (neuronal)
domestic guinea pig(100734964) cholinergic receptor, nicotinic, alpha 2 (neuronal)
naked mole-rat(101714975) cholinergic receptor, nicotinic, alpha 2 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N0267 (±)-Nicotine ≥99% (TLC), liquid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120491 MISSION® esiRNA esiRNA human CHRNA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000742 Rosetta Predictions human pricing
NM_133420 Rosetta Predictions rat pricing
NM_144803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171989 predicted 1370
2 SASI_Hs01_00171990 predicted 2011
3 SASI_Hs02_00303168 predicted 2493
4 SASI_Hs01_00171993 predicted 1212
5 SASI_Hs01_00171994 predicted 1315
6 SASI_Hs02_00303169 predicted 2481
7 SASI_Hs01_00171995 predicted 2055
8 SASI_Hs01_00171996 predicted 2023
9 SASI_Hs02_00303170 predicted 2336
10 SASI_Hs01_00171997 predicted 1179
11 SASI_Hs01_00171991 predicted 2055
12 SASI_Hs01_00171992 predicted 2236
13 SASI_Hs01_00171998 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064522 predicted 557
2 SASI_Rn01_00064523 predicted 1625
3 SASI_Rn01_00064524 predicted 322
4 SASI_Rn01_00064525 predicted 1648
5 SASI_Rn01_00064526 predicted 941
6 SASI_Rn01_00064527 predicted 946
7 SASI_Rn01_00064528 predicted 1662
8 SASI_Rn01_00064529 predicted 1651
9 SASI_Rn02_00267677 predicted 1650
10 SASI_Rn01_00064530 predicted 1448
11 SASI_Rn01_00064531 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167306 predicted 762
2 SASI_Mm01_00167307 predicted 503
3 SASI_Mm01_00167309 predicted 1651
4 SASI_Mm01_00167310 predicted 1644
5 SASI_Mm01_00167311 predicted 471
6 SASI_Mm01_00167312 predicted 312
7 SASI_Mm01_00167313 predicted 1526
8 SASI_Mm01_00167314 predicted 364
9 SASI_Mm01_00167315 predicted 1639
10 SASI_Mm02_00340153 predicted 314
11 SASI_Mm01_00167308 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000742
CHRNA2 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 2 (neuronal)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-1130s1c1
Sequence:CCGGCGACCAGCAGAACTGCAAGATCTCGAGATCTTGCAGTTCTGCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-1962s1c1
Sequence:CCGGCTGGAAGGTGTGCACTACATTCTCGAGAATGTAGTGCACACCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-2122s1c1
Sequence:CCGGCGTTCCTAGCTGGAATGATCTCTCGAGAGATCATTCCAGCTAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-785s1c1
Sequence:CCGGGCCCAACACTTCAGACGTGGTCTCGAGACCACGTCTGAAGTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-938s1c1
Sequence:CCGGCAACATCACATCTCTCAGGGTCTCGAGACCCTGAGAGATGTGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000742.3-947s21c1
Sequence:CCGGAGGAGTGGAGCGACTACAAACCTCGAGGTTTGTAGTCGCTCCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000742.3-2501s21c1
Sequence:CCGGCTAAGTGACAGAAGGGTCAACCTCGAGGTTGACCCTTCTGTCACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000742.3-2344s21c1
Sequence:CCGGCCATCCAGCTTAACGTTATTGCTCGAGCAATAACGTTAAGCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000742.3-883s21c1
Sequence:CCGGATCGCTCAGCTCATCGATGTGCTCGAGCACATCGATGAGCTGAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000742
CHRNA2 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 2 (neuronal)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-1130s1c1
Sequence:CCGGCGACCAGCAGAACTGCAAGATCTCGAGATCTTGCAGTTCTGCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-1962s1c1
Sequence:CCGGCTGGAAGGTGTGCACTACATTCTCGAGAATGTAGTGCACACCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-2122s1c1
Sequence:CCGGCGTTCCTAGCTGGAATGATCTCTCGAGAGATCATTCCAGCTAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-785s1c1
Sequence:CCGGGCCCAACACTTCAGACGTGGTCTCGAGACCACGTCTGAAGTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-938s1c1
Sequence:CCGGCAACATCACATCTCTCAGGGTCTCGAGACCCTGAGAGATGTGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000742.3-947s21c1
Sequence:CCGGAGGAGTGGAGCGACTACAAACCTCGAGGTTTGTAGTCGCTCCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000742.3-2501s21c1
Sequence:CCGGCTAAGTGACAGAAGGGTCAACCTCGAGGTTGACCCTTCTGTCACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000742.3-2344s21c1
Sequence:CCGGCCATCCAGCTTAACGTTATTGCTCGAGCAATAACGTTAAGCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000742.3-883s21c1
Sequence:CCGGATCGCTCAGCTCATCGATGTGCTCGAGCACATCGATGAGCTGAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000742
CHRNA2 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 2 (neuronal)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-1130s1c1
Sequence:CCGGCGACCAGCAGAACTGCAAGATCTCGAGATCTTGCAGTTCTGCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-1962s1c1
Sequence:CCGGCTGGAAGGTGTGCACTACATTCTCGAGAATGTAGTGCACACCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-2122s1c1
Sequence:CCGGCGTTCCTAGCTGGAATGATCTCTCGAGAGATCATTCCAGCTAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-785s1c1
Sequence:CCGGGCCCAACACTTCAGACGTGGTCTCGAGACCACGTCTGAAGTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000742.1-938s1c1
Sequence:CCGGCAACATCACATCTCTCAGGGTCTCGAGACCCTGAGAGATGTGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000742.3-947s21c1
Sequence:CCGGAGGAGTGGAGCGACTACAAACCTCGAGGTTTGTAGTCGCTCCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000742.3-2501s21c1
Sequence:CCGGCTAAGTGACAGAAGGGTCAACCTCGAGGTTGACCCTTCTGTCACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000742.3-2344s21c1
Sequence:CCGGCCATCCAGCTTAACGTTATTGCTCGAGCAATAACGTTAAGCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000742.3-883s21c1
Sequence:CCGGATCGCTCAGCTCATCGATGTGCTCGAGCACATCGATGAGCTGAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144803
CHRNA2 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 2 (neuronal)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144803.1-1854s1c1
Sequence:CCGGCCACTCAACATGACAACTATTCTCGAGAATAGTTGTCATGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-473s1c1
Sequence:CCGGCCCAGACATTGTTCTCTACAACTCGAGTTGTAGAGAACAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-758s1c1
Sequence:CCGGCGGAACCTATAACAGCAAGAACTCGAGTTCTTGCTGTTATAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-1583s1c1
Sequence:CCGGGCTGTTCATTATCGTCTGCTTCTCGAGAAGCAGACGATAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-980s1c1
Sequence:CCGGGCTGCTCATCACAGAAATTATCTCGAGATAATTTCTGTGATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144803.2-299s21c1
Sequence:CCGGCATCGTGCGCTTTGGACTATCCTCGAGGATAGTCCAAAGCGCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144803.2-1719s21c1
Sequence:CCGGGGAGCCATCTCTAGAATATTCCTCGAGGAATATTCTAGAGATGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144803.2-241s21c1
Sequence:CCGGACCTCTTTGGAGGCTACAATCCTCGAGGATTGTAGCCTCCAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144803
CHRNA2 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 2 (neuronal)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144803.1-1854s1c1
Sequence:CCGGCCACTCAACATGACAACTATTCTCGAGAATAGTTGTCATGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-473s1c1
Sequence:CCGGCCCAGACATTGTTCTCTACAACTCGAGTTGTAGAGAACAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-758s1c1
Sequence:CCGGCGGAACCTATAACAGCAAGAACTCGAGTTCTTGCTGTTATAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-1583s1c1
Sequence:CCGGGCTGTTCATTATCGTCTGCTTCTCGAGAAGCAGACGATAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-980s1c1
Sequence:CCGGGCTGCTCATCACAGAAATTATCTCGAGATAATTTCTGTGATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144803.2-299s21c1
Sequence:CCGGCATCGTGCGCTTTGGACTATCCTCGAGGATAGTCCAAAGCGCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144803.2-1719s21c1
Sequence:CCGGGGAGCCATCTCTAGAATATTCCTCGAGGAATATTCTAGAGATGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144803.2-241s21c1
Sequence:CCGGACCTCTTTGGAGGCTACAATCCTCGAGGATTGTAGCCTCCAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144803
CHRNA2 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 2 (neuronal)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144803.1-1854s1c1
Sequence:CCGGCCACTCAACATGACAACTATTCTCGAGAATAGTTGTCATGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-473s1c1
Sequence:CCGGCCCAGACATTGTTCTCTACAACTCGAGTTGTAGAGAACAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-758s1c1
Sequence:CCGGCGGAACCTATAACAGCAAGAACTCGAGTTCTTGCTGTTATAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-1583s1c1
Sequence:CCGGGCTGTTCATTATCGTCTGCTTCTCGAGAAGCAGACGATAATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144803.1-980s1c1
Sequence:CCGGGCTGCTCATCACAGAAATTATCTCGAGATAATTTCTGTGATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144803.2-299s21c1
Sequence:CCGGCATCGTGCGCTTTGGACTATCCTCGAGGATAGTCCAAAGCGCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144803.2-1719s21c1
Sequence:CCGGGGAGCCATCTCTAGAATATTCCTCGAGGAATATTCTAGAGATGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144803.2-241s21c1
Sequence:CCGGACCTCTTTGGAGGCTACAATCCTCGAGGATTGTAGCCTCCAAAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks