EMAIL THIS PAGE TO A FRIEND

CHRNA3

cholinergic receptor, nicotinic, alpha 3 (neuronal)

77 Gene Product Result for
Synonyms: LNCR2 NACHRA3 PAOD2
Gene ID:
Human(1136) Summary: This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
Mouse(110834) cholinergic receptor, nicotinic, alpha polypeptide 3
Rat(25101) cholinergic receptor, nicotinic, alpha 3 (neuronal)
Zebrafish(568467) cholinergic receptor, nicotinic, alpha 3
dog(482111) cholinergic receptor, nicotinic, alpha 3 (neuronal)
domestic cat(100037403) cholinergic receptor, nicotinic, alpha 3 (neuronal)
cow(282702) cholinergic receptor, nicotinic, alpha 3 (neuronal)
chicken(386578) cholinergic receptor, nicotinic, alpha 3
naked mole-rat(101701279) cholinergic receptor, nicotinic, alpha 3 (neuronal)
domestic guinea pig(100730977) cholinergic receptor, nicotinic, alpha 3 (neuronal)
sheep(101123239) cholinergic receptor, nicotinic, alpha 3 (neuronal)
Domestic Rabbit(100342666) cholinergic receptor, nicotinic, alpha 3 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000743 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000743 Rosetta Predictions human pricing
NM_052805 Rosetta Predictions rat pricing
NM_145129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189258 predicted 541
2 SASI_Hs01_00189259 predicted 1523
3 SASI_Hs01_00189260 predicted 667
4 SASI_Hs01_00189261 predicted 763
5 SASI_Hs01_00189262 predicted 1491
6 SASI_Hs01_00189263 predicted 628
7 SASI_Hs01_00189264 predicted 830
8 SASI_Hs01_00189265 predicted 869
9 SASI_Hs01_00189266 predicted 564
10 SASI_Hs01_00189267 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079366 predicted 962
2 SASI_Rn02_00265596 predicted 515
3 SASI_Rn01_00079369 predicted 1230
4 SASI_Rn02_00265597 predicted 994
5 SASI_Rn02_00265598 predicted 229
6 SASI_Rn02_00265599 predicted 643
7 SASI_Rn01_00079371 predicted 417
8 SASI_Rn01_00079372 predicted 925
9 SASI_Rn02_00265600 predicted 275
10 SASI_Rn02_00265601 predicted 919
11 SASI_Rn01_00079367 predicted 1707
12 SASI_Rn01_00079368 predicted 1626
13 SASI_Rn01_00079370 predicted 523
14 SASI_Rn01_00079373 predicted 1503
15 SASI_Rn01_00079374 predicted 448
16 SASI_Rn01_00079375 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081400 predicted 634
2 SASI_Mm01_00081401 predicted 1395
3 SASI_Mm01_00081402 predicted 1126
4 SASI_Mm01_00081403 predicted 324
5 SASI_Mm01_00081404 predicted 1243
6 SASI_Mm01_00081405 predicted 752
7 SASI_Mm01_00081406 predicted 994
8 SASI_Mm01_00081407 predicted 584
9 SASI_Mm01_00081408 predicted 1102
10 SASI_Mm01_00081409 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145129
CHRNA3 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 3 (neuronal)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145129.2-2010s21c1
Sequence:CCGGCACTTCCATTCTTTACTATTTCTCGAGAAATAGTAAAGAATGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145129.2-1758s21c1
Sequence:CCGGTTGCTATTTCAAGGGTTATTTCTCGAGAAATAACCCTTGAAATAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145129.2-1965s1c1
Sequence:CCGGCCCATAAACTACTTGAAGTTACTCGAGTAACTTCAAGTAGTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1478s1c1
Sequence:CCGGCCATCCAAAGTGTGAAGTATACTCGAGTATACTTCACACTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1561s1c1
Sequence:CCGGGCCATGGTGATTGATCGCATTCTCGAGAATGCGATCAATCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1245s1c1
Sequence:CCGGCCCAAAGACGAGGAACTTCTACTCGAGTAGAAGTTCCTCGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145129
CHRNA3 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 3 (neuronal)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145129.2-2010s21c1
Sequence:CCGGCACTTCCATTCTTTACTATTTCTCGAGAAATAGTAAAGAATGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145129.2-1758s21c1
Sequence:CCGGTTGCTATTTCAAGGGTTATTTCTCGAGAAATAACCCTTGAAATAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145129.2-1965s1c1
Sequence:CCGGCCCATAAACTACTTGAAGTTACTCGAGTAACTTCAAGTAGTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1478s1c1
Sequence:CCGGCCATCCAAAGTGTGAAGTATACTCGAGTATACTTCACACTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1561s1c1
Sequence:CCGGGCCATGGTGATTGATCGCATTCTCGAGAATGCGATCAATCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1245s1c1
Sequence:CCGGCCCAAAGACGAGGAACTTCTACTCGAGTAGAAGTTCCTCGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145129
CHRNA3 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 3 (neuronal)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145129.2-2010s21c1
Sequence:CCGGCACTTCCATTCTTTACTATTTCTCGAGAAATAGTAAAGAATGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145129.2-1758s21c1
Sequence:CCGGTTGCTATTTCAAGGGTTATTTCTCGAGAAATAACCCTTGAAATAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145129.2-1965s1c1
Sequence:CCGGCCCATAAACTACTTGAAGTTACTCGAGTAACTTCAAGTAGTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1478s1c1
Sequence:CCGGCCATCCAAAGTGTGAAGTATACTCGAGTATACTTCACACTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1561s1c1
Sequence:CCGGGCCATGGTGATTGATCGCATTCTCGAGAATGCGATCAATCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145129.2-1245s1c1
Sequence:CCGGCCCAAAGACGAGGAACTTCTACTCGAGTAGAAGTTCCTCGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000743
CHRNA3 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 3 (neuronal)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-307s1c1
Sequence:CCGGCGGCTGTTTGAAGATTACAATCTCGAGATTGTAATCTTCAAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-1601s1c1
Sequence:CCGGCCATGGTGATTGATCGTATTTCTCGAGAAATACGATCAATCACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-1309s1c1
Sequence:CCGGGCCGAGCTCTCAAATCTGAATCTCGAGATTCAGATTTGAGAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-295s1c1
Sequence:CCGGCGTCTATTTGAGCGGCTGTTTCTCGAGAAACAGCCGCTCAAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-873s1c1
Sequence:CCGGCGACATCACATACTCGCTGTACTCGAGTACAGCGAGTATGTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000743
CHRNA3 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 3 (neuronal)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-307s1c1
Sequence:CCGGCGGCTGTTTGAAGATTACAATCTCGAGATTGTAATCTTCAAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-1601s1c1
Sequence:CCGGCCATGGTGATTGATCGTATTTCTCGAGAAATACGATCAATCACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-1309s1c1
Sequence:CCGGGCCGAGCTCTCAAATCTGAATCTCGAGATTCAGATTTGAGAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-295s1c1
Sequence:CCGGCGTCTATTTGAGCGGCTGTTTCTCGAGAAACAGCCGCTCAAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-873s1c1
Sequence:CCGGCGACATCACATACTCGCTGTACTCGAGTACAGCGAGTATGTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000743
CHRNA3 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 3 (neuronal)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-307s1c1
Sequence:CCGGCGGCTGTTTGAAGATTACAATCTCGAGATTGTAATCTTCAAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-1601s1c1
Sequence:CCGGCCATGGTGATTGATCGTATTTCTCGAGAAATACGATCAATCACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-1309s1c1
Sequence:CCGGGCCGAGCTCTCAAATCTGAATCTCGAGATTCAGATTTGAGAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-295s1c1
Sequence:CCGGCGTCTATTTGAGCGGCTGTTTCTCGAGAAACAGCCGCTCAAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000743.2-873s1c1
Sequence:CCGGCGACATCACATACTCGCTGTACTCGAGTACAGCGAGTATGTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks