EMAIL THIS PAGE TO A FRIEND

CHRNA4

cholinergic receptor, nicotinic, alpha 4 (neuronal)

76 Gene Product Result for
Synonyms: BFNC EBN EBN1 NACHR NACHRA4 NACRA4
UniProtKB ID: P43681, Q4JGR7, Q4VAQ6
Gene ID:
Human(1137) Summary: This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(11438) cholinergic receptor, nicotinic, alpha polypeptide 4
Rat(25590) cholinergic receptor, nicotinic, alpha 4 (neuronal)
sheep(101118889) cholinergic receptor, nicotinic, alpha 4 (neuronal)
Domestic Rabbit(100345481) cholinergic receptor, nicotinic, alpha 4 (neuronal)
domestic guinea pig(100716877) cholinergic receptor, nicotinic, alpha 4 (neuronal)
naked mole-rat(101714448) cholinergic receptor, nicotinic, alpha 4 (neuronal)
Zebrafish(556619) cholinergic receptor, nicotinic, alpha 4
domestic cat(101101300) cholinergic receptor, nicotinic, alpha 4 (neuronal)
cow(537251) cholinergic receptor, nicotinic, alpha 4
Horse(100146784) cholinergic receptor, nicotinic, alpha 4 (neuronal)
dog(485972) cholinergic receptor, nicotinic, alpha 4 (neuronal)
chicken(395606) cholinergic receptor, nicotinic, alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000744 Rosetta Predictions human pricing
NM_024354 Rosetta Predictions rat pricing
NM_015730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058542 predicted 2519
2 SASI_Hs01_00058543 predicted 1975
3 SASI_Hs01_00058544 predicted 866
4 SASI_Hs01_00058545 predicted 827
5 SASI_Hs01_00058546 predicted 1277
6 SASI_Hs01_00058547 predicted 719
7 SASI_Hs01_00058548 predicted 1810
8 SASI_Hs01_00058549 predicted 2048
9 SASI_Hs01_00058550 predicted 815
10 SASI_Hs02_00303171 predicted 1893
11 SASI_Hs01_00058541 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063440 predicted 1710
2 SASI_Rn01_00063441 predicted 1815
3 SASI_Rn01_00063442 predicted 1122
4 SASI_Rn01_00063443 predicted 570
5 SASI_Rn01_00063444 predicted 1101
6 SASI_Rn01_00063446 predicted 1120
7 SASI_Rn01_00063447 predicted 582
8 SASI_Rn01_00063448 predicted 655
9 SASI_Rn01_00063449 predicted 1808
10 SASI_Rn02_00263912 predicted 519
11 SASI_Rn01_00063445 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158616 predicted 1800
2 SASI_Mm01_00158617 predicted 1900
3 SASI_Mm01_00158618 predicted 753
4 SASI_Mm01_00158620 predicted 1975
5 SASI_Mm01_00158621 predicted 1361
6 SASI_Mm01_00158622 predicted 1214
7 SASI_Mm01_00158623 predicted 1570
8 SASI_Mm01_00158624 predicted 986
9 SASI_Mm01_00158625 predicted 1325
10 SASI_Mm02_00323054 predicted 1199
11 SASI_Mm01_00158619 predicted 1905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000744
CHRNA4 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 4 (neuronal)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-1341s1c1
Sequence:CCGGGCTCATCGAGTCCATGCATAACTCGAGTTATGCATGGACTCGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-357s1c1
Sequence:CCGGGAAACTCTTCTCCGGTTACAACTCGAGTTGTAACCGGAGAAGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-1814s1c1
Sequence:CCGGCGTGCAAATGCACATGCAAGACTCGAGTCTTGCATGTGCATTTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-472s1c1
Sequence:CCGGCAGATGATGACCACGAACGTACTCGAGTACGTTCGTGGTCATCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-921s1c1
Sequence:CCGGCCCGGACATCACCTATGCCTTCTCGAGAAGGCATAGGTGATGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000744
CHRNA4 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 4 (neuronal)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-1341s1c1
Sequence:CCGGGCTCATCGAGTCCATGCATAACTCGAGTTATGCATGGACTCGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-357s1c1
Sequence:CCGGGAAACTCTTCTCCGGTTACAACTCGAGTTGTAACCGGAGAAGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-1814s1c1
Sequence:CCGGCGTGCAAATGCACATGCAAGACTCGAGTCTTGCATGTGCATTTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-472s1c1
Sequence:CCGGCAGATGATGACCACGAACGTACTCGAGTACGTTCGTGGTCATCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-921s1c1
Sequence:CCGGCCCGGACATCACCTATGCCTTCTCGAGAAGGCATAGGTGATGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000744
CHRNA4 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 4 (neuronal)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-1341s1c1
Sequence:CCGGGCTCATCGAGTCCATGCATAACTCGAGTTATGCATGGACTCGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-357s1c1
Sequence:CCGGGAAACTCTTCTCCGGTTACAACTCGAGTTGTAACCGGAGAAGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-1814s1c1
Sequence:CCGGCGTGCAAATGCACATGCAAGACTCGAGTCTTGCATGTGCATTTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-472s1c1
Sequence:CCGGCAGATGATGACCACGAACGTACTCGAGTACGTTCGTGGTCATCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000744.2-921s1c1
Sequence:CCGGCCCGGACATCACCTATGCCTTCTCGAGAAGGCATAGGTGATGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015730
CHRNA4 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 4 (neuronal)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000103021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-1214s1c1
Sequence:CCGGCCGGAGACTTATCGAATCCATCTCGAGATGGATTCGATAAGTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-1572s1c1
Sequence:CCGGCGGAGTATCCAGTACTGTGTTCTCGAGAACACAGTACTGGATACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-270s1c1
Sequence:CCGGCCAGTAGCCAATATCTCAGATCTCGAGATCTGAGATATTGGCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-758s1c1
Sequence:CCGGCACCTACAACACCAGGAAGTACTCGAGTACTTCCTGGTGTTGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015730
CHRNA4 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 4 (neuronal)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000103021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-1214s1c1
Sequence:CCGGCCGGAGACTTATCGAATCCATCTCGAGATGGATTCGATAAGTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-1572s1c1
Sequence:CCGGCGGAGTATCCAGTACTGTGTTCTCGAGAACACAGTACTGGATACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-270s1c1
Sequence:CCGGCCAGTAGCCAATATCTCAGATCTCGAGATCTGAGATATTGGCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-758s1c1
Sequence:CCGGCACCTACAACACCAGGAAGTACTCGAGTACTTCCTGGTGTTGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015730
CHRNA4 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 4 (neuronal)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000103021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-1214s1c1
Sequence:CCGGCCGGAGACTTATCGAATCCATCTCGAGATGGATTCGATAAGTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-1572s1c1
Sequence:CCGGCGGAGTATCCAGTACTGTGTTCTCGAGAACACAGTACTGGATACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-270s1c1
Sequence:CCGGCCAGTAGCCAATATCTCAGATCTCGAGATCTGAGATATTGGCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015730.4-758s1c1
Sequence:CCGGCACCTACAACACCAGGAAGTACTCGAGTACTTCCTGGTGTTGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)