EMAIL THIS PAGE TO A FRIEND

CHRNA5

cholinergic receptor, nicotinic, alpha 5 (neuronal)

70 Gene Product Result for
Synonyms: LNCR2
UniProtKB ID: P30532, Q15824, Q99554
Gene ID:
Human(1138) Summary: The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
Mouse(110835) cholinergic receptor, nicotinic, alpha polypeptide 5
Rat(25102) cholinergic receptor, nicotinic, alpha 5 (neuronal)
Zebrafish(550584) cholinergic receptor, nicotinic, alpha 5
domestic cat(101090440) cholinergic receptor, nicotinic, alpha 5 (neuronal)
dog(482112) cholinergic receptor, nicotinic, alpha 5 (neuronal)
cow(282177) cholinergic receptor, nicotinic, alpha 5
chicken(386577) cholinergic receptor, nicotinic, alpha 5 (neuronal)
naked mole-rat(101714878) cholinergic receptor, nicotinic, alpha 5 (neuronal)
sheep(101115407) cholinergic receptor, nicotinic, alpha 5 (neuronal)
Domestic Rabbit(100342408) cholinergic receptor, nicotinic, alpha 5 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M9020 Mecamylamine hydrochloride human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000745 Rosetta Predictions human pricing
NM_017078 Rosetta Predictions rat pricing
NM_176844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224875 predicted 959
2 SASI_Hs01_00224877 predicted 696
3 SASI_Hs01_00224878 predicted 1101
4 SASI_Hs01_00224879 predicted 971
5 SASI_Hs01_00224881 predicted 486
6 SASI_Hs01_00224882 predicted 1581
7 SASI_Hs02_00303172 predicted 612
8 SASI_Hs01_00224883 predicted 710
9 SASI_Hs01_00224884 predicted 664
10 SASI_Hs02_00303173 predicted 1254
11 SASI_Hs01_00224876 predicted 886
12 SASI_Hs01_00224880 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047006 predicted 1149
2 SASI_Rn02_00261290 predicted 948
3 SASI_Rn02_00261291 predicted 1538
4 SASI_Rn01_00047007 predicted 836
5 SASI_Rn01_00047009 predicted 1499
6 SASI_Rn02_00261292 predicted 369
7 SASI_Rn01_00047010 predicted 328
8 SASI_Rn01_00047011 predicted 1518
9 SASI_Rn01_00047012 predicted 392
10 SASI_Rn01_00047013 predicted 806
11 SASI_Rn01_00047004 predicted 1537
12 SASI_Rn01_00047005 predicted 1553
13 SASI_Rn01_00047008 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098510 predicted 808
2 SASI_Mm01_00098511 predicted 415
3 SASI_Mm01_00098512 predicted 1053
4 SASI_Mm01_00098513 predicted 1012
5 SASI_Mm01_00098514 predicted 229
6 SASI_Mm01_00098515 predicted 1055
7 SASI_Mm01_00098516 predicted 1067
8 SASI_Mm01_00098517 predicted 1023
9 SASI_Mm01_00098518 predicted 415
10 SASI_Mm01_00098519 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176844
CHRNA5 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 5 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-661s1c1
Sequence:CCGGCCTCTCTTCTACACCCTGTTTCTCGAGAAACAGGGTGTAGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-1098s1c1
Sequence:CCGGGCTCGATTGCATTCGCTACATCTCGAGATGTAGCGAATGCAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-802s1c1
Sequence:CCGGCTGGTGATTGAGGAAATTATACTCGAGTATAATTTCCTCAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-961s1c1
Sequence:CCGGCCGTGGGTTCGTAAGATATTTCTCGAGAAATATCTTACGAACCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-464s1c1
Sequence:CCGGGCTCCATGAAATTCGGCTCATCTCGAGATGAGCCGAATTTCATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176844
CHRNA5 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 5 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-661s1c1
Sequence:CCGGCCTCTCTTCTACACCCTGTTTCTCGAGAAACAGGGTGTAGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-1098s1c1
Sequence:CCGGGCTCGATTGCATTCGCTACATCTCGAGATGTAGCGAATGCAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-802s1c1
Sequence:CCGGCTGGTGATTGAGGAAATTATACTCGAGTATAATTTCCTCAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-961s1c1
Sequence:CCGGCCGTGGGTTCGTAAGATATTTCTCGAGAAATATCTTACGAACCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-464s1c1
Sequence:CCGGGCTCCATGAAATTCGGCTCATCTCGAGATGAGCCGAATTTCATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176844
CHRNA5 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 5 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-661s1c1
Sequence:CCGGCCTCTCTTCTACACCCTGTTTCTCGAGAAACAGGGTGTAGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-1098s1c1
Sequence:CCGGGCTCGATTGCATTCGCTACATCTCGAGATGTAGCGAATGCAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-802s1c1
Sequence:CCGGCTGGTGATTGAGGAAATTATACTCGAGTATAATTTCCTCAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-961s1c1
Sequence:CCGGCCGTGGGTTCGTAAGATATTTCTCGAGAAATATCTTACGAACCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176844.3-464s1c1
Sequence:CCGGGCTCCATGAAATTCGGCTCATCTCGAGATGAGCCGAATTTCATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000745
VALIDATED
CHRNA5 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 5 (neuronal)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-1350s1c1
Sequence:CCGGGCTCGATTCTATTCGCTACATCTCGAGATGTAGCGAATAGAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-973s1c1
Sequence:CCGGGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-702s1c1
Sequence:CCGGCCTTCAGAACTGTTCCATGAACTCGAGTTCATGGAACAGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-496s1c1
Sequence:CCGGCCTGATGACTATGGTGGAATACTCGAGTATTCCACCATAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000745.2-1434s1c1
Sequence:CCGGCCAGGTTCTTGATCGGATGTTCTCGAGAACATCCGATCAAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-702s21c1
Sequence:CCGGCCTTCAGAACTGTTCCATGAACTCGAGTTCATGGAACAGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-973s21c1
Sequence:CCGGGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-496s21c1
Sequence:CCGGCCTGATGACTATGGTGGAATACTCGAGTATTCCACCATAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-1350s21c1
Sequence:CCGGGCTCGATTCTATTCGCTACATCTCGAGATGTAGCGAATAGAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000745
VALIDATED
CHRNA5 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 5 (neuronal)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-1350s1c1
Sequence:CCGGGCTCGATTCTATTCGCTACATCTCGAGATGTAGCGAATAGAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-973s1c1
Sequence:CCGGGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-702s1c1
Sequence:CCGGCCTTCAGAACTGTTCCATGAACTCGAGTTCATGGAACAGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-496s1c1
Sequence:CCGGCCTGATGACTATGGTGGAATACTCGAGTATTCCACCATAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000745.2-1434s1c1
Sequence:CCGGCCAGGTTCTTGATCGGATGTTCTCGAGAACATCCGATCAAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-702s21c1
Sequence:CCGGCCTTCAGAACTGTTCCATGAACTCGAGTTCATGGAACAGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-973s21c1
Sequence:CCGGGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-496s21c1
Sequence:CCGGCCTGATGACTATGGTGGAATACTCGAGTATTCCACCATAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-1350s21c1
Sequence:CCGGGCTCGATTCTATTCGCTACATCTCGAGATGTAGCGAATAGAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000745
VALIDATED
CHRNA5 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 5 (neuronal)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-1350s1c1
Sequence:CCGGGCTCGATTCTATTCGCTACATCTCGAGATGTAGCGAATAGAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-973s1c1
Sequence:CCGGGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-702s1c1
Sequence:CCGGCCTTCAGAACTGTTCCATGAACTCGAGTTCATGGAACAGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000745.2-496s1c1
Sequence:CCGGCCTGATGACTATGGTGGAATACTCGAGTATTCCACCATAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000745.2-1434s1c1
Sequence:CCGGCCAGGTTCTTGATCGGATGTTCTCGAGAACATCCGATCAAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-702s21c1
Sequence:CCGGCCTTCAGAACTGTTCCATGAACTCGAGTTCATGGAACAGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-973s21c1
Sequence:CCGGGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-496s21c1
Sequence:CCGGCCTGATGACTATGGTGGAATACTCGAGTATTCCACCATAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000745.2-1350s21c1
Sequence:CCGGGCTCGATTCTATTCGCTACATCTCGAGATGTAGCGAATAGAATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks