EMAIL THIS PAGE TO A FRIEND

CHRNA6

cholinergic receptor, nicotinic, alpha 6 (neuronal)

55 Gene Product Result for
Synonyms: CHNRA6
UniProtKB ID: Q15825, B2R8V4, B4DQH1
Gene ID:
Human(8973) Summary: This gene encodes an alpha subunit of neuronal nicotinic acetylcholine receptors. These receptors consist of five subunits and function as ion channels involved in neurotransmission. The encoded protein is a subunit of neuronal nicotinic acetylcholine receptors that mediate dopaminergic neurotransmission and are activated by acetylcholine and exogenous nicotine. Alternatively spliced transcript variants have been observed for this gene. Single nucleotide polymorphisms in this gene have been associated with both nicotine and alcohol dependence. [provided by RefSeq, Dec 2010]
Mouse(11440) cholinergic receptor, nicotinic, alpha polypeptide 6
Rat(81721) cholinergic receptor, nicotinic, alpha 6 (neuronal)
sheep(101119532) cholinergic receptor, nicotinic, alpha 6 (neuronal)
Domestic Rabbit(100355656) cholinergic receptor, nicotinic, alpha 6 (neuronal)
domestic guinea pig(100723150) cholinergic receptor, nicotinic, alpha 6 (neuronal)
naked mole-rat(101712413) cholinergic receptor, nicotinic, alpha 6 (neuronal)
Zebrafish(555747) cholinergic receptor, nicotinic, alpha 6
cow(539113) cholinergic receptor, nicotinic, alpha 6 (neuronal)
Horse(100049908) cholinergic receptor, nicotinic, alpha 6 (neuronal)
domestic cat(101098219) cholinergic receptor, nicotinic, alpha 6 (neuronal)
dog(482836) cholinergic receptor, nicotinic, alpha 6 (neuronal)
chicken(396321) cholinergic receptor, nicotinic, alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M9020 Mecamylamine hydrochloride human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036041 MISSION® esiRNA esiRNA human CHRNA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004198 Rosetta Predictions human pricing
NM_057184 Rosetta Predictions rat pricing
NM_021369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202337 predicted 679
2 SASI_Hs01_00202338 predicted 1465
3 SASI_Hs01_00202339 predicted 284
4 SASI_Hs01_00202340 predicted 360
5 SASI_Hs01_00202341 predicted 778
6 SASI_Hs01_00202343 predicted 1223
7 SASI_Hs01_00202344 predicted 591
8 SASI_Hs01_00202345 predicted 302
9 SASI_Hs02_00337095 predicted 787
10 SASI_Hs01_00202346 predicted 343
11 SASI_Hs01_00202342 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053377 predicted 1136
2 SASI_Rn01_00053378 predicted 453
3 SASI_Rn01_00053379 predicted 749
4 SASI_Rn01_00053380 predicted 843
5 SASI_Rn01_00053382 predicted 1527
6 SASI_Rn01_00053383 predicted 1255
7 SASI_Rn02_00267134 predicted 721
8 SASI_Rn01_00053384 predicted 1464
9 SASI_Rn01_00053385 predicted 1450
10 SASI_Rn01_00053386 predicted 530
11 SASI_Rn01_00053381 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073785 predicted 1576
2 SASI_Mm01_00073786 predicted 1799
3 SASI_Mm02_00325958 predicted 533
4 SASI_Mm01_00073787 predicted 597
5 SASI_Mm01_00073788 predicted 921
6 SASI_Mm01_00073789 predicted 661
7 SASI_Mm01_00073790 predicted 1168
8 SASI_Mm01_00073791 predicted 804
9 SASI_Mm01_00073792 predicted 1566
10 SASI_Mm01_00073794 predicted 483
11 SASI_Mm01_00073793 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004198
CHRNA6 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 6 (neuronal)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004198.2-1554s21c1
Sequence:CCGGGAAATTTACAGACACCATATTCTCGAGAATATGGTGTCTGTAAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-672s21c1
Sequence:CCGGTTGATGCCTCTGGCTACAAACCTCGAGGTTTGTAGCCAGAGGCATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-1440s21c1
Sequence:CCGGGAGTATTTCTTTGGGTATTTACTCGAGTAAATACCCAAAGAAATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-372s21c1
Sequence:CCGGGCGTTCCTGCAGATAAGATTTCTCGAGAAATCTTATCTGCAGGAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-751s1c1
Sequence:CCGGCATTAGAAGATTGCCGATGTTCTCGAGAACATCGGCAATCTTCTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-341s1c1
Sequence:CCGGCCAATGGAATATGATGGCATTCTCGAGAATGCCATCATATTCCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-904s1c1
Sequence:CCGGGCTGGTCATCACAGAAACCATCTCGAGATGGTTTCTGTGATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-1259s1c1
Sequence:CCGGGCCACAAGCAAGAGAAGATTACTCGAGTAATCTTCTCTTGCTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004198
CHRNA6 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 6 (neuronal)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004198.2-1554s21c1
Sequence:CCGGGAAATTTACAGACACCATATTCTCGAGAATATGGTGTCTGTAAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-672s21c1
Sequence:CCGGTTGATGCCTCTGGCTACAAACCTCGAGGTTTGTAGCCAGAGGCATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-1440s21c1
Sequence:CCGGGAGTATTTCTTTGGGTATTTACTCGAGTAAATACCCAAAGAAATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-372s21c1
Sequence:CCGGGCGTTCCTGCAGATAAGATTTCTCGAGAAATCTTATCTGCAGGAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-751s1c1
Sequence:CCGGCATTAGAAGATTGCCGATGTTCTCGAGAACATCGGCAATCTTCTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-341s1c1
Sequence:CCGGCCAATGGAATATGATGGCATTCTCGAGAATGCCATCATATTCCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-904s1c1
Sequence:CCGGGCTGGTCATCACAGAAACCATCTCGAGATGGTTTCTGTGATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-1259s1c1
Sequence:CCGGGCCACAAGCAAGAGAAGATTACTCGAGTAATCTTCTCTTGCTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004198
CHRNA6 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 6 (neuronal)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004198.2-1554s21c1
Sequence:CCGGGAAATTTACAGACACCATATTCTCGAGAATATGGTGTCTGTAAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-672s21c1
Sequence:CCGGTTGATGCCTCTGGCTACAAACCTCGAGGTTTGTAGCCAGAGGCATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-1440s21c1
Sequence:CCGGGAGTATTTCTTTGGGTATTTACTCGAGTAAATACCCAAAGAAATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004198.2-372s21c1
Sequence:CCGGGCGTTCCTGCAGATAAGATTTCTCGAGAAATCTTATCTGCAGGAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-751s1c1
Sequence:CCGGCATTAGAAGATTGCCGATGTTCTCGAGAACATCGGCAATCTTCTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-341s1c1
Sequence:CCGGCCAATGGAATATGATGGCATTCTCGAGAATGCCATCATATTCCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-904s1c1
Sequence:CCGGGCTGGTCATCACAGAAACCATCTCGAGATGGTTTCTGTGATGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004198.2-1259s1c1
Sequence:CCGGGCCACAAGCAAGAGAAGATTACTCGAGTAATCTTCTCTTGCTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021369
CHRNA6 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 6 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-277s1c1
Sequence:CCGGCCGGTTTATGTCTGTGGCTATCTCGAGATAGCCACAGACATAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021369.2-2561s1c1
Sequence:CCGGCGTGGAGGAATCAGTCTCTAACTCGAGTTAGAGACTGATTCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-803s1c1
Sequence:CCGGCCTTCTCATCATTGGCTCTAACTCGAGTTAGAGCCAATGATGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-1045s1c1
Sequence:CCGGGTGGCGAGAAAGTGACTCTTTCTCGAGAAAGAGTCACTTTCTCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-779s1c1
Sequence:CCGGGACTTATGACAAGGCAGAAATCTCGAGATTTCTGCCTTGTCATAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021369
CHRNA6 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 6 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-277s1c1
Sequence:CCGGCCGGTTTATGTCTGTGGCTATCTCGAGATAGCCACAGACATAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021369.2-2561s1c1
Sequence:CCGGCGTGGAGGAATCAGTCTCTAACTCGAGTTAGAGACTGATTCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-803s1c1
Sequence:CCGGCCTTCTCATCATTGGCTCTAACTCGAGTTAGAGCCAATGATGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-1045s1c1
Sequence:CCGGGTGGCGAGAAAGTGACTCTTTCTCGAGAAAGAGTCACTTTCTCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-779s1c1
Sequence:CCGGGACTTATGACAAGGCAGAAATCTCGAGATTTCTGCCTTGTCATAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021369
CHRNA6 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 6 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-277s1c1
Sequence:CCGGCCGGTTTATGTCTGTGGCTATCTCGAGATAGCCACAGACATAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021369.2-2561s1c1
Sequence:CCGGCGTGGAGGAATCAGTCTCTAACTCGAGTTAGAGACTGATTCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-803s1c1
Sequence:CCGGCCTTCTCATCATTGGCTCTAACTCGAGTTAGAGCCAATGATGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-1045s1c1
Sequence:CCGGGTGGCGAGAAAGTGACTCTTTCTCGAGAAAGAGTCACTTTCTCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021369.2-779s1c1
Sequence:CCGGGACTTATGACAAGGCAGAAATCTCGAGATTTCTGCCTTGTCATAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)