EMAIL THIS PAGE TO A FRIEND

CHRNA7

cholinergic receptor, nicotinic, alpha 7 (neuronal)

76 Gene Product Result for
Synonyms: CHRNA7-2 NACHRA7
Gene ID:
Human(1139) Summary: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(11441) cholinergic receptor, nicotinic, alpha polypeptide 7
Rat(25302) cholinergic receptor, nicotinic, alpha 7 (neuronal)
Zebrafish(394199) cholinergic receptor, nicotinic, alpha polypeptide 7
cow(282178) cholinergic receptor, nicotinic, alpha 7
Horse(100060521) cholinergic receptor, nicotinic, alpha 7 (neuronal)
domestic cat(751113) cholinergic receptor, nicotinic, alpha 7 (neuronal)
dog(488696) cholinergic receptor, nicotinic, alpha 7 (neuronal)
chicken(374001) cholinergic receptor, nicotinic, alpha 7 (neuronal)
naked mole-rat(101720562) cholinergic receptor, nicotinic, alpha 7 (neuronal)
domestic guinea pig(100720640) cholinergic receptor, nicotinic, alpha 7 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108456 Anti-CHRNA7 IgG fraction of antiserum bovine, rat, human, mouse
western blot pricing
AV13018 Anti-CHRNA7 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, rat, human
western blot pricing
M220 Monoclonal Anti-Nicotinic Acetylcholine Receptor (α7 Subunit) antibody produced in mouse ~5 mg/mL, clone mAb 306, purified immunoglobulin, buffered aqueous solution human (denatured), rat (denatured), chicken
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000746 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020481 MISSION® esiRNA esiRNA targeting mouse Chrna7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000746 Rosetta Predictions human pricing
NM_012832 Rosetta Predictions rat pricing
NM_007390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153871 predicted 449
2 SASI_Hs01_00153872 predicted 688
3 SASI_Hs01_00153874 predicted 878
4 SASI_Hs01_00153876 predicted 426
5 SASI_Hs01_00153877 predicted 621
6 SASI_Hs01_00153879 predicted 463
7 SASI_Hs01_00153880 predicted 1384
8 SASI_Hs02_00303174 predicted 294
9 SASI_Hs02_00303175 predicted 903
10 SASI_Hs02_00303176 predicted 360
11 SASI_Hs01_00153873 predicted 1655
12 SASI_Hs01_00153875 predicted 296
13 SASI_Hs01_00153878 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260294 predicted 858
2 SASI_Rn02_00260295 predicted 228
3 SASI_Rn02_00260296 predicted 694
4 SASI_Rn01_00098652 predicted 789
5 SASI_Rn01_00098653 predicted 411
6 SASI_Rn01_00098654 predicted 547
7 SASI_Rn01_00098656 predicted 615
8 SASI_Rn01_00098657 predicted 836
9 SASI_Rn02_00260297 predicted 277
10 SASI_Rn02_00260298 predicted 387
11 SASI_Rn01_00098648 predicted 1561
12 SASI_Rn01_00098649 predicted 1403
13 SASI_Rn01_00098650 predicted 1532
14 SASI_Rn01_00098651 predicted 1471
15 SASI_Rn01_00098655 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107238 predicted 499
2 SASI_Mm01_00107239 predicted 1406
3 SASI_Mm01_00107240 predicted 841
4 SASI_Mm01_00107241 predicted 882
5 SASI_Mm01_00107242 predicted 455
6 SASI_Mm01_00107243 predicted 601
7 SASI_Mm01_00107244 predicted 698
8 SASI_Mm01_00107245 predicted 902
9 SASI_Mm01_00107246 predicted 1618
10 SASI_Mm01_00107247 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007390
CHRNA7 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 7 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007390.2-1704s1c1
Sequence:CCGGCCCAGCAGCTTCTGTTTACTTCTCGAGAAGTAAACAGAAGCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-377s1c1
Sequence:CCGGCTCCTCTATAACAGTGCAGATCTCGAGATCTGCACTGTTATAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-1032s1c1
Sequence:CCGGCCAGGATCATTCTTCTGAATTCTCGAGAATTCAGAAGAATGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-356s1c1
Sequence:CCGGCAGATTTGGAAACCAGACATTCTCGAGAATGTCTGGTTTCCAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-301s1c1
Sequence:CCGGGCAGTGGAACATGTCTGAGTACTCGAGTACTCAGACATGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007390
CHRNA7 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 7 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007390.2-1704s1c1
Sequence:CCGGCCCAGCAGCTTCTGTTTACTTCTCGAGAAGTAAACAGAAGCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-377s1c1
Sequence:CCGGCTCCTCTATAACAGTGCAGATCTCGAGATCTGCACTGTTATAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-1032s1c1
Sequence:CCGGCCAGGATCATTCTTCTGAATTCTCGAGAATTCAGAAGAATGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-356s1c1
Sequence:CCGGCAGATTTGGAAACCAGACATTCTCGAGAATGTCTGGTTTCCAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-301s1c1
Sequence:CCGGGCAGTGGAACATGTCTGAGTACTCGAGTACTCAGACATGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007390
CHRNA7 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 7 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007390.2-1704s1c1
Sequence:CCGGCCCAGCAGCTTCTGTTTACTTCTCGAGAAGTAAACAGAAGCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-377s1c1
Sequence:CCGGCTCCTCTATAACAGTGCAGATCTCGAGATCTGCACTGTTATAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-1032s1c1
Sequence:CCGGCCAGGATCATTCTTCTGAATTCTCGAGAATTCAGAAGAATGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-356s1c1
Sequence:CCGGCAGATTTGGAAACCAGACATTCTCGAGAATGTCTGGTTTCCAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007390.2-301s1c1
Sequence:CCGGGCAGTGGAACATGTCTGAGTACTCGAGTACTCAGACATGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000746
CHRNA7 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 7 (neuronal)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-322s1c1
Sequence:CCGGGATCACTATTTACAGTGGAATCTCGAGATTCCACTGTAAATAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-141s1c1
Sequence:CCGGCGAGTTCCAGAGGAAGCTTTACTCGAGTAAAGCTTCCTCTGGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-216s1c1
Sequence:CCGGGCAACCACTCACCGTCTACTTCTCGAGAAGTAGACGGTGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-396s1c1
Sequence:CCGGGAAACCAGACATTCTTCTCTACTCGAGTAGAGAAGAATGTCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-359s21c1
Sequence:CCGGGGGTGAAGACTGTTCGTTTCCCTCGAGGGAAACGAACAGTCTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-306s21c1
Sequence:CCGGGCAAATGTCTTGGACAGATCACTCGAGTGATCTGTCCAAGACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-251s21c1
Sequence:CCGGTGCAGATCATGGACGTGGATGCTCGAGCATCCACGTCCATGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-1002s21c1
Sequence:CCGGGACAGTGATCGTGCTGCAGTACTCGAGTACTGCAGCACGATCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-419s21c1
Sequence:CCGGACAGTGCTGATGAGCGCTTTGCTCGAGCAAAGCGCTCATCAGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000746
CHRNA7 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 7 (neuronal)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-322s1c1
Sequence:CCGGGATCACTATTTACAGTGGAATCTCGAGATTCCACTGTAAATAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-141s1c1
Sequence:CCGGCGAGTTCCAGAGGAAGCTTTACTCGAGTAAAGCTTCCTCTGGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-216s1c1
Sequence:CCGGGCAACCACTCACCGTCTACTTCTCGAGAAGTAGACGGTGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-396s1c1
Sequence:CCGGGAAACCAGACATTCTTCTCTACTCGAGTAGAGAAGAATGTCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-359s21c1
Sequence:CCGGGGGTGAAGACTGTTCGTTTCCCTCGAGGGAAACGAACAGTCTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-306s21c1
Sequence:CCGGGCAAATGTCTTGGACAGATCACTCGAGTGATCTGTCCAAGACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-251s21c1
Sequence:CCGGTGCAGATCATGGACGTGGATGCTCGAGCATCCACGTCCATGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-1002s21c1
Sequence:CCGGGACAGTGATCGTGCTGCAGTACTCGAGTACTGCAGCACGATCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-419s21c1
Sequence:CCGGACAGTGCTGATGAGCGCTTTGCTCGAGCAAAGCGCTCATCAGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000746
CHRNA7 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 7 (neuronal)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-322s1c1
Sequence:CCGGGATCACTATTTACAGTGGAATCTCGAGATTCCACTGTAAATAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-141s1c1
Sequence:CCGGCGAGTTCCAGAGGAAGCTTTACTCGAGTAAAGCTTCCTCTGGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-216s1c1
Sequence:CCGGGCAACCACTCACCGTCTACTTCTCGAGAAGTAGACGGTGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000746.2-396s1c1
Sequence:CCGGGAAACCAGACATTCTTCTCTACTCGAGTAGAGAAGAATGTCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-359s21c1
Sequence:CCGGGGGTGAAGACTGTTCGTTTCCCTCGAGGGAAACGAACAGTCTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-306s21c1
Sequence:CCGGGCAAATGTCTTGGACAGATCACTCGAGTGATCTGTCCAAGACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-251s21c1
Sequence:CCGGTGCAGATCATGGACGTGGATGCTCGAGCATCCACGTCCATGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-1002s21c1
Sequence:CCGGGACAGTGATCGTGCTGCAGTACTCGAGTACTGCAGCACGATCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000746.3-419s21c1
Sequence:CCGGACAGTGCTGATGAGCGCTTTGCTCGAGCAAAGCGCTCATCAGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks