EMAIL THIS PAGE TO A FRIEND

CHRNA9

cholinergic receptor, nicotinic, alpha 9 (neuronal)

66 Gene Product Result for
Synonyms: HSA243342 NACHRA9
UniProtKB ID: Q9UGM1, Q14CY7, Q4W5A2, Q9NYV2
Gene ID:
Human(55584) Summary: This gene is a member of the ligand-gated ionic channel family and nicotinic acetylcholine receptor gene superfamily. It encodes a plasma membrane protein that forms homo- or hetero-oligomeric divalent cation channels. This protein is involved in cochlea hair cell development and is also expressed in the outer hair cells (OHCs) of the adult cochlea. [provided by RefSeq, Feb 2012]
Mouse(231252) cholinergic receptor, nicotinic, alpha polypeptide 9
Rat(65024) cholinergic receptor, nicotinic, alpha 9 (neuronal)
domestic guinea pig(100736216) cholinergic receptor, nicotinic, alpha 9 (neuronal)
naked mole-rat(101705029) cholinergic receptor, nicotinic, alpha 9 (neuronal)
sheep(101115624) cholinergic receptor, nicotinic, alpha 9 (neuronal)
Zebrafish(568807) cholinergic receptor, nicotinic, alpha 9
chicken(395522) cholinergic receptor, nicotinic, alpha 9
cow(521876) cholinergic receptor, nicotinic, alpha 9
Horse(100054940) cholinergic receptor, nicotinic, alpha 9 (neuronal)
domestic cat(101081220) cholinergic receptor, nicotinic, alpha 9 (neuronal)
dog(488832) cholinergic receptor, nicotinic, alpha 9 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV13019 Anti-CHRNA9 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, zebrafish, mouse, bovine, canine
western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M9020 Mecamylamine hydrochloride human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017581 Rosetta Predictions human pricing
NM_022930 Rosetta Predictions rat pricing
NM_001081104 Rosetta Predictions mouse pricing
XM_132045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016994 predicted 902
2 SASI_Hs01_00016995 predicted 1414
3 SASI_Hs01_00016996 predicted 552
4 SASI_Hs02_00350245 predicted 1366
5 SASI_Hs01_00016997 predicted 1053
6 SASI_Hs01_00016998 predicted 413
7 SASI_Hs01_00016999 predicted 1509
8 SASI_Hs01_00017000 predicted 1446
9 SASI_Hs01_00017001 predicted 1256
10 SASI_Hs01_00017002 predicted 222
11 SASI_Hs01_00017003 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113521 predicted 1342
2 SASI_Rn01_00113522 predicted 1126
3 SASI_Rn01_00113523 predicted 1032
4 SASI_Rn01_00113524 predicted 1426
5 SASI_Rn02_00263624 predicted 1439
6 SASI_Rn01_00113525 predicted 621
7 SASI_Rn01_00113526 predicted 899
8 SASI_Rn01_00113527 predicted 309
9 SASI_Rn01_00113528 predicted 793
10 SASI_Rn01_00113529 predicted 1488
11 SASI_Rn01_00113530 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295221 predicted 413
2 SASI_Mm02_00295222 predicted 1362
3 SASI_Mm02_00295223 predicted 1138
4 SASI_Mm02_00295224 predicted 1260
5 SASI_Mm02_00295225 predicted 417
6 SASI_Mm02_00295226 predicted 1431
7 SASI_Mm02_00295227 predicted 447
8 SASI_Mm02_00295228 predicted 377
9 SASI_Mm02_00295229 predicted 1354
10 SASI_Mm02_00295230 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211637 predicted 1579
2 SASI_Mm01_00211638 predicted 1570
3 SASI_Mm01_00211639 predicted 1361
4 SASI_Mm01_00211640 predicted 1148
5 SASI_Mm01_00211641 predicted 1432
6 SASI_Mm01_00211642 predicted 1265
7 SASI_Mm01_00211643 predicted 899
8 SASI_Mm01_00211644 predicted 1442
9 SASI_Mm01_00211645 predicted 1065
10 SASI_Mm01_00211646 predicted 1436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017581
CHRNA9 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 9 (neuronal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017581.2-1702s21c1
Sequence:CCGGGGGTGACTGGCCTCTAGTTTACTCGAGTAAACTAGAGGCCAGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017581.2-1435s21c1
Sequence:CCGGGATCATAGCAAGAGCGGATTACTCGAGTAATCCGCTCTTGCTATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-907s1c1
Sequence:CCGGCCTGATAGGTAAATACTACATCTCGAGATGTAGTATTTACCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-204s1c1
Sequence:CCGGCGCTCTCTCAGATTAAGGATACTCGAGTATCCTTAATCTGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-848s1c1
Sequence:CCGGGCCATGACTGTATTTCAGCTACTCGAGTAGCTGAAATACAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-1355s1c1
Sequence:CCGGGAATGGAAGAAGGTGGCGAAACTCGAGTTTCGCCACCTTCTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-1258s1c1
Sequence:CCGGCGAGAGTTACTGTGCACAGTACTCGAGTACTGTGCACAGTAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017581
CHRNA9 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 9 (neuronal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017581.2-1702s21c1
Sequence:CCGGGGGTGACTGGCCTCTAGTTTACTCGAGTAAACTAGAGGCCAGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017581.2-1435s21c1
Sequence:CCGGGATCATAGCAAGAGCGGATTACTCGAGTAATCCGCTCTTGCTATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-907s1c1
Sequence:CCGGCCTGATAGGTAAATACTACATCTCGAGATGTAGTATTTACCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-204s1c1
Sequence:CCGGCGCTCTCTCAGATTAAGGATACTCGAGTATCCTTAATCTGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-848s1c1
Sequence:CCGGGCCATGACTGTATTTCAGCTACTCGAGTAGCTGAAATACAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-1355s1c1
Sequence:CCGGGAATGGAAGAAGGTGGCGAAACTCGAGTTTCGCCACCTTCTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-1258s1c1
Sequence:CCGGCGAGAGTTACTGTGCACAGTACTCGAGTACTGTGCACAGTAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017581
CHRNA9 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 9 (neuronal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017581.2-1702s21c1
Sequence:CCGGGGGTGACTGGCCTCTAGTTTACTCGAGTAAACTAGAGGCCAGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017581.2-1435s21c1
Sequence:CCGGGATCATAGCAAGAGCGGATTACTCGAGTAATCCGCTCTTGCTATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-907s1c1
Sequence:CCGGCCTGATAGGTAAATACTACATCTCGAGATGTAGTATTTACCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-204s1c1
Sequence:CCGGCGCTCTCTCAGATTAAGGATACTCGAGTATCCTTAATCTGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-848s1c1
Sequence:CCGGGCCATGACTGTATTTCAGCTACTCGAGTAGCTGAAATACAGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-1355s1c1
Sequence:CCGGGAATGGAAGAAGGTGGCGAAACTCGAGTTTCGCCACCTTCTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017581.1-1258s1c1
Sequence:CCGGCGAGAGTTACTGTGCACAGTACTCGAGTACTGTGCACAGTAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081104
CHRNA9 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 9 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081104.1-1785s21c1
Sequence:CCGGTTGGTAGGCATTCGATATTTGCTCGAGCAAATATCGAATGCCTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-789s21c1
Sequence:CCGGTGTGGTGGATGTCACCTATTTCTCGAGAAATAGGTGACATCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-842s21c1
Sequence:CCGGTTGGTTCCTGGACCTACAATGCTCGAGCATTGTAGGTCCAGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-1730s21c1
Sequence:CCGGTCATGACCGTCTTGATCATAGCTCGAGCTATGATCAAGACGGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-508s21c1
Sequence:CCGGGTCACGCTCTCCCAGATAAAGCTCGAGCTTTATCTGGGAGAGCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081104
CHRNA9 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 9 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081104.1-1785s21c1
Sequence:CCGGTTGGTAGGCATTCGATATTTGCTCGAGCAAATATCGAATGCCTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-789s21c1
Sequence:CCGGTGTGGTGGATGTCACCTATTTCTCGAGAAATAGGTGACATCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-842s21c1
Sequence:CCGGTTGGTTCCTGGACCTACAATGCTCGAGCATTGTAGGTCCAGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-1730s21c1
Sequence:CCGGTCATGACCGTCTTGATCATAGCTCGAGCTATGATCAAGACGGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-508s21c1
Sequence:CCGGGTCACGCTCTCCCAGATAAAGCTCGAGCTTTATCTGGGAGAGCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081104
CHRNA9 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 9 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081104.1-1785s21c1
Sequence:CCGGTTGGTAGGCATTCGATATTTGCTCGAGCAAATATCGAATGCCTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-789s21c1
Sequence:CCGGTGTGGTGGATGTCACCTATTTCTCGAGAAATAGGTGACATCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-842s21c1
Sequence:CCGGTTGGTTCCTGGACCTACAATGCTCGAGCATTGTAGGTCCAGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-1730s21c1
Sequence:CCGGTCATGACCGTCTTGATCATAGCTCGAGCTATGATCAAGACGGTCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081104.1-508s21c1
Sequence:CCGGGTCACGCTCTCCCAGATAAAGCTCGAGCTTTATCTGGGAGAGCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks