EMAIL THIS PAGE TO A FRIEND

CHRNB1

cholinergic receptor, nicotinic, beta 1 (muscle)

72 Gene Product Result for
Synonyms: ACHRB CHRNB CMS1D CMS2A SCCMS
UniProtKB ID: P11230, Q96FB8
Gene ID:
Human(1140) Summary: The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
Mouse(11443) cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Rat(24261) cholinergic receptor, nicotinic, beta 1 (muscle)
Zebrafish(100006941) cholinergic receptor, nicotinic, beta 1 (muscle)
cow(282179) cholinergic receptor, nicotinic, beta 1 (muscle)
Horse(100072990) cholinergic receptor, nicotinic, beta 1 (muscle)
domestic cat(101097433) cholinergic receptor, nicotinic, beta 1 (muscle)
dog(489473) cholinergic receptor, nicotinic, beta 1 (muscle)
sheep(101121614) cholinergic receptor, nicotinic, beta 1 (muscle)
Domestic Rabbit(100357163) cholinergic receptor, nicotinic, beta 1 (muscle)
naked mole-rat(101723288) cholinergic receptor, nicotinic, beta 1 (muscle)
domestic guinea pig(100714100) cholinergic receptor, nicotinic, beta 1 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000747 Rosetta Predictions human pricing
NM_012528 Rosetta Predictions rat pricing
NM_009601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104091 predicted 247
2 SASI_Hs01_00104092 predicted 1290
3 SASI_Hs02_00303177 predicted 1076
4 SASI_Hs01_00104093 predicted 385
5 SASI_Hs01_00104094 predicted 254
6 SASI_Hs01_00104095 predicted 659
7 SASI_Hs01_00104096 predicted 250
8 SASI_Hs02_00303178 predicted 529
9 SASI_Hs01_00104097 predicted 802
10 SASI_Hs01_00104099 predicted 222
11 SASI_Hs01_00104098 predicted 273
12 SASI_Hs01_00104100 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078649 predicted 1167
2 SASI_Rn01_00078650 predicted 701
3 SASI_Rn01_00078651 predicted 282
4 SASI_Rn01_00078652 predicted 694
5 SASI_Rn02_00259603 predicted 272
6 SASI_Rn02_00259604 predicted 415
7 SASI_Rn01_00078654 predicted 988
8 SASI_Rn01_00078655 predicted 1427
9 SASI_Rn01_00078656 predicted 1132
10 SASI_Rn01_00078657 predicted 678
11 SASI_Rn01_00078653 predicted 1013
12 SASI_Rn01_00078658 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071068 predicted 969
2 SASI_Mm01_00071069 predicted 688
3 SASI_Mm01_00071070 predicted 655
4 SASI_Mm01_00071071 predicted 1360
5 SASI_Mm01_00071072 predicted 1413
6 SASI_Mm01_00071074 predicted 1308
7 SASI_Mm01_00071075 predicted 333
8 SASI_Mm01_00071076 predicted 1121
9 SASI_Mm02_00316527 predicted 438
10 SASI_Mm02_00316528 predicted 843
11 SASI_Mm01_00071073 predicted 287
12 SASI_Mm01_00071077 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009601
VALIDATED
CHRNB1 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 1 (muscle)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009601.3-1835s1c1
Sequence:CCGGCCCAACAATGTTACTTCCTTACTCGAGTAAGGAAGTAACATTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-409s1c1
Sequence:CCGGGCTGAACAACAATGACGGAAACTCGAGTTTCCGTCATTGTTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009601.3-704s1c1
Sequence:CCGGCCTTCTAGGTTAATCCAACTTCTCGAGAAGTTGGATTAACCTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-1176s1c1
Sequence:CCGGCTGAACCACATCACTCTCTTTCTCGAGAAAGAGAGTGATGTGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-683s1c1
Sequence:CCGGCAATGGGAGATTATCCACAAACTCGAGTTTGTGGATAATCTCCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-134s21c1
Sequence:CCGGGCCGAAGGCCAACTGATTAAGCTCGAGCTTAATCAGTTGGCCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-405s21c1
Sequence:CCGGTGAACAACAATGACGGAAATTCTCGAGAATTTCCGTCATTGTTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-304s21c1
Sequence:CCGGGTGGACCGACTACAGGTTAAGCTCGAGCTTAACCTGTAGTCGGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-1519s21c1
Sequence:CCGGCCTAGATGCCACGTACCATTTCTCGAGAAATGGTACGTGGCATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009601.4-1613s21c1
Sequence:CCGGATAGCGCTTGGCGCTTGTAAGCTCGAGCTTACAAGCGCCAAGCGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009601
VALIDATED
CHRNB1 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 1 (muscle)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009601.3-1835s1c1
Sequence:CCGGCCCAACAATGTTACTTCCTTACTCGAGTAAGGAAGTAACATTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-409s1c1
Sequence:CCGGGCTGAACAACAATGACGGAAACTCGAGTTTCCGTCATTGTTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009601.3-704s1c1
Sequence:CCGGCCTTCTAGGTTAATCCAACTTCTCGAGAAGTTGGATTAACCTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-1176s1c1
Sequence:CCGGCTGAACCACATCACTCTCTTTCTCGAGAAAGAGAGTGATGTGGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-683s1c1
Sequence:CCGGCAATGGGAGATTATCCACAAACTCGAGTTTGTGGATAATCTCCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-134s21c1
Sequence:CCGGGCCGAAGGCCAACTGATTAAGCTCGAGCTTAATCAGTTGGCCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-405s21c1
Sequence:CCGGTGAACAACAATGACGGAAATTCTCGAGAATTTCCGTCATTGTTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-304s21c1
Sequence:CCGGGTGGACCGACTACAGGTTAAGCTCGAGCTTAACCTGTAGTCGGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-1519s21c1
Sequence:CCGGCCTAGATGCCACGTACCATTTCTCGAGAAATGGTACGTGGCATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009601.4-1613s21c1
Sequence:CCGGATAGCGCTTGGCGCTTGTAAGCTCGAGCTTACAAGCGCCAAGCGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009601
VALIDATED
CHRNB1 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 1 (muscle)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009601.3-1835s1c1
Sequence:CCGGCCCAACAATGTTACTTCCTTACTCGAGTAAGGAAGTAACATTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-409s1c1
Sequence:CCGGGCTGAACAACAATGACGGAAACTCGAGTTTCCGTCATTGTTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009601.3-704s1c1
Sequence:CCGGCCTTCTAGGTTAATCCAACTTCTCGAGAAGTTGGATTAACCTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-1176s1c1
Sequence:CCGGCTGAACCACATCACTCTCTTTCTCGAGAAAGAGAGTGATGTGGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009601.3-683s1c1
Sequence:CCGGCAATGGGAGATTATCCACAAACTCGAGTTTGTGGATAATCTCCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-134s21c1
Sequence:CCGGGCCGAAGGCCAACTGATTAAGCTCGAGCTTAATCAGTTGGCCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-405s21c1
Sequence:CCGGTGAACAACAATGACGGAAATTCTCGAGAATTTCCGTCATTGTTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-304s21c1
Sequence:CCGGGTGGACCGACTACAGGTTAAGCTCGAGCTTAACCTGTAGTCGGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009601.4-1519s21c1
Sequence:CCGGCCTAGATGCCACGTACCATTTCTCGAGAAATGGTACGTGGCATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009601.4-1613s21c1
Sequence:CCGGATAGCGCTTGGCGCTTGTAAGCTCGAGCTTACAAGCGCCAAGCGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000747
CHRNB1 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 1 (muscle)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-943s1c1
Sequence:CCGGCCTCACTATCAGTACCCATTACTCGAGTAATGGGTACTGATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-527s1c1
Sequence:CCGGGCAGAATTGCACTATGGTGTTCTCGAGAACACCATAGTGCAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-659s1c1
Sequence:CCGGCCAGTGGGAGATTATCCACAACTCGAGTTGTGGATAATCTCCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-257s1c1
Sequence:CCGGGATGAGCACAAAGGTGTACTTCTCGAGAAGTACACCTTTGTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-1349s1c1
Sequence:CCGGCGTCTCCTCTATCAGCTACATCTCGAGATGTAGCTGATAGAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000747.2-1280s21c1
Sequence:CCGGCCCTGATCTGCGGCGATTTATCTCGAGATAAATCGCCGCAGATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000747.2-1727s21c1
Sequence:CCGGATGCAGTATCATCTGATTTACCTCGAGGTAAATCAGATGATACTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000747
CHRNB1 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 1 (muscle)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-943s1c1
Sequence:CCGGCCTCACTATCAGTACCCATTACTCGAGTAATGGGTACTGATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-527s1c1
Sequence:CCGGGCAGAATTGCACTATGGTGTTCTCGAGAACACCATAGTGCAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-659s1c1
Sequence:CCGGCCAGTGGGAGATTATCCACAACTCGAGTTGTGGATAATCTCCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-257s1c1
Sequence:CCGGGATGAGCACAAAGGTGTACTTCTCGAGAAGTACACCTTTGTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-1349s1c1
Sequence:CCGGCGTCTCCTCTATCAGCTACATCTCGAGATGTAGCTGATAGAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000747.2-1280s21c1
Sequence:CCGGCCCTGATCTGCGGCGATTTATCTCGAGATAAATCGCCGCAGATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000747.2-1727s21c1
Sequence:CCGGATGCAGTATCATCTGATTTACCTCGAGGTAAATCAGATGATACTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000747
CHRNB1 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 1 (muscle)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-943s1c1
Sequence:CCGGCCTCACTATCAGTACCCATTACTCGAGTAATGGGTACTGATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-527s1c1
Sequence:CCGGGCAGAATTGCACTATGGTGTTCTCGAGAACACCATAGTGCAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-659s1c1
Sequence:CCGGCCAGTGGGAGATTATCCACAACTCGAGTTGTGGATAATCTCCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-257s1c1
Sequence:CCGGGATGAGCACAAAGGTGTACTTCTCGAGAAGTACACCTTTGTGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000747.2-1349s1c1
Sequence:CCGGCGTCTCCTCTATCAGCTACATCTCGAGATGTAGCTGATAGAGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000747.2-1280s21c1
Sequence:CCGGCCCTGATCTGCGGCGATTTATCTCGAGATAAATCGCCGCAGATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000747.2-1727s21c1
Sequence:CCGGATGCAGTATCATCTGATTTACCTCGAGGTAAATCAGATGATACTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)