EMAIL THIS PAGE TO A FRIEND

CHRNB3

cholinergic receptor, nicotinic, beta 3 (neuronal)

81 Gene Product Result for
UniProtKB ID: Q05901, Q15827
Gene ID:
Human(1142) Summary: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]
Mouse(108043) cholinergic receptor, nicotinic, beta polypeptide 3
Rat(171131) cholinergic receptor, nicotinic, beta 3 (neuronal)
chicken(395604) cholinergic receptor, nicotinic, beta 3 (neuronal)
cow(521702) cholinergic receptor, nicotinic, beta 3 (neuronal)
Horse(100054095) cholinergic receptor, nicotinic, beta 3 (neuronal)
dog(482837) cholinergic receptor, nicotinic, beta 3 (neuronal)
domestic cat(101098624) cholinergic receptor, nicotinic, beta 3 (neuronal)
sheep(101122833) cholinergic receptor, nicotinic, beta 3 (neuronal)
Domestic Rabbit(100355898) cholinergic receptor, nicotinic, beta 3 (neuronal)
naked mole-rat(101706291) cholinergic receptor, nicotinic, beta 3 (neuronal)
domestic guinea pig(100723424) cholinergic receptor, nicotinic, beta 3 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M9020 Mecamylamine hydrochloride human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000749 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000749 Rosetta Predictions human pricing
NM_133597 Rosetta Predictions rat pricing
NM_027454 Rosetta Predictions mouse pricing
NM_173212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203224 predicted 365
2 SASI_Hs01_00203225 predicted 1441
3 SASI_Hs02_00303179 predicted 1060
4 SASI_Hs02_00303180 predicted 348
5 SASI_Hs01_00203227 predicted 1387
6 SASI_Hs01_00203229 predicted 1088
7 SASI_Hs02_00303181 predicted 1537
8 SASI_Hs01_00203231 predicted 1125
9 SASI_Hs01_00203232 predicted 972
10 SASI_Hs01_00203233 predicted 1208
11 SASI_Hs01_00203226 predicted 793
12 SASI_Hs01_00203228 predicted 1016
13 SASI_Hs01_00203230 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082065 predicted 476
2 SASI_Rn02_00267808 predicted 1006
3 SASI_Rn01_00082067 predicted 1664
4 SASI_Rn01_00082068 predicted 1041
5 SASI_Rn01_00082069 predicted 1453
6 SASI_Rn01_00082070 predicted 1158
7 SASI_Rn02_00267809 predicted 406
8 SASI_Rn01_00082071 predicted 1386
9 SASI_Rn01_00082073 predicted 1579
10 SASI_Rn01_00082074 predicted 490
11 SASI_Rn01_00082066 predicted 445
12 SASI_Rn01_00082072 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117511 predicted 1246
2 SASI_Mm02_00332220 predicted 1115
3 SASI_Mm02_00332221 predicted 1009
4 SASI_Mm01_00117513 predicted 1575
5 SASI_Mm02_00332222 predicted 948
6 SASI_Mm02_00332223 predicted 705
7 SASI_Mm01_00117516 predicted 1380
8 SASI_Mm01_00117517 predicted 617
9 SASI_Mm02_00332224 predicted 1512
10 SASI_Mm02_00332225 predicted 821
11 SASI_Mm01_00117512 predicted 1790
12 SASI_Mm01_00117514 predicted 1750
13 SASI_Mm01_00117515 predicted 1733
14 SASI_Mm01_00117518 predicted 1353
15 SASI_Mm01_00117519 predicted 1422
16 SASI_Mm01_00117520 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188079 predicted 1360
2 SASI_Mm02_00345161 predicted 1232
3 SASI_Mm02_00345162 predicted 1119
4 SASI_Mm01_00188081 predicted 1689
5 SASI_Mm02_00345163 predicted 1068
6 SASI_Mm02_00345164 predicted 819
7 SASI_Mm01_00188084 predicted 1501
8 SASI_Mm01_00188085 predicted 724
9 SASI_Mm02_00345165 predicted 1628
10 SASI_Mm02_00345166 predicted 929
11 SASI_Mm01_00188080 predicted 1908
12 SASI_Mm01_00188082 predicted 1867
13 SASI_Mm01_00188083 predicted 1845
14 SASI_Mm01_00188086 predicted 1476
15 SASI_Mm01_00188087 predicted 1537
16 SASI_Mm01_00188088 predicted 1636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027454
CHRNB3 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 3 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027454.1-1722s1c1
Sequence:CCGGGCTGCCATTAGAGATGTATTTCTCGAGAAATACATCTCTAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-441s1c1
Sequence:CCGGCCCGAAGACTATGGTGGAATTCTCGAGAATTCCACCATAGTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-1086s1c1
Sequence:CCGGCTGTCTATTATTGTCACGGTTCTCGAGAACCGTGACAATAATAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-1124s1c1
Sequence:CCGGCCACAGATCTTCCTCAACGTACTCGAGTACGTTGAGGAAGATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-443s1c1
Sequence:CCGGCGAAGACTATGGTGGAATTAACTCGAGTTAATTCCACCATAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027454
CHRNB3 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 3 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027454.1-1722s1c1
Sequence:CCGGGCTGCCATTAGAGATGTATTTCTCGAGAAATACATCTCTAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-441s1c1
Sequence:CCGGCCCGAAGACTATGGTGGAATTCTCGAGAATTCCACCATAGTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-1086s1c1
Sequence:CCGGCTGTCTATTATTGTCACGGTTCTCGAGAACCGTGACAATAATAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-1124s1c1
Sequence:CCGGCCACAGATCTTCCTCAACGTACTCGAGTACGTTGAGGAAGATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-443s1c1
Sequence:CCGGCGAAGACTATGGTGGAATTAACTCGAGTTAATTCCACCATAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027454
CHRNB3 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 3 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027454.1-1722s1c1
Sequence:CCGGGCTGCCATTAGAGATGTATTTCTCGAGAAATACATCTCTAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-441s1c1
Sequence:CCGGCCCGAAGACTATGGTGGAATTCTCGAGAATTCCACCATAGTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-1086s1c1
Sequence:CCGGCTGTCTATTATTGTCACGGTTCTCGAGAACCGTGACAATAATAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-1124s1c1
Sequence:CCGGCCACAGATCTTCCTCAACGTACTCGAGTACGTTGAGGAAGATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027454.1-443s1c1
Sequence:CCGGCGAAGACTATGGTGGAATTAACTCGAGTTAATTCCACCATAGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000749
CHRNB3 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 3 (neuronal)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-824s1c1
Sequence:CCGGGCCTTTATTCTATACCCTCTTCTCGAGAAGAGGGTATAGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-1473s1c1
Sequence:CCGGGCTTTGAAGATGTGGCTACATCTCGAGATGTAGCCACATCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-261s1c1
Sequence:CCGGCGCCCTGTATTACATTCTAATCTCGAGATTAGAATGTAATACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-1314s1c1
Sequence:CCGGGCTGATTCCATTAGATACATTCTCGAGAATGTATCTAATGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-784s1c1
Sequence:CCGGCCTATCCCTTTATCACGTATTCTCGAGAATACGTGATAAAGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-988s21c1
Sequence:CCGGCATCGTCTTCCAAAGTCATTCCTCGAGGAATGACTTTGGAAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-1371s21c1
Sequence:CCGGGTAGTACAAGACTGGAAATTTCTCGAGAAATTTCCAGTCTTGTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000749.3-1638s21c1
Sequence:CCGGATGGGAGAAACTCTGGTAAATCTCGAGATTTACCAGAGTTTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-398s21c1
Sequence:CCGGACGCTGGAATCCTGATGATTACTCGAGTAATCATCAGGATTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-261s21c1
Sequence:CCGGCGCCCTGTATTACATTCTAATCTCGAGATTAGAATGTAATACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-517s21c1
Sequence:CCGGTGACCAAGGTCATCGTGAAATCTCGAGATTTCACGATGACCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000749
CHRNB3 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 3 (neuronal)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-824s1c1
Sequence:CCGGGCCTTTATTCTATACCCTCTTCTCGAGAAGAGGGTATAGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-1473s1c1
Sequence:CCGGGCTTTGAAGATGTGGCTACATCTCGAGATGTAGCCACATCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-261s1c1
Sequence:CCGGCGCCCTGTATTACATTCTAATCTCGAGATTAGAATGTAATACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-1314s1c1
Sequence:CCGGGCTGATTCCATTAGATACATTCTCGAGAATGTATCTAATGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-784s1c1
Sequence:CCGGCCTATCCCTTTATCACGTATTCTCGAGAATACGTGATAAAGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-988s21c1
Sequence:CCGGCATCGTCTTCCAAAGTCATTCCTCGAGGAATGACTTTGGAAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-1371s21c1
Sequence:CCGGGTAGTACAAGACTGGAAATTTCTCGAGAAATTTCCAGTCTTGTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000749.3-1638s21c1
Sequence:CCGGATGGGAGAAACTCTGGTAAATCTCGAGATTTACCAGAGTTTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-398s21c1
Sequence:CCGGACGCTGGAATCCTGATGATTACTCGAGTAATCATCAGGATTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-261s21c1
Sequence:CCGGCGCCCTGTATTACATTCTAATCTCGAGATTAGAATGTAATACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-517s21c1
Sequence:CCGGTGACCAAGGTCATCGTGAAATCTCGAGATTTCACGATGACCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000749
CHRNB3 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 3 (neuronal)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-824s1c1
Sequence:CCGGGCCTTTATTCTATACCCTCTTCTCGAGAAGAGGGTATAGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-1473s1c1
Sequence:CCGGGCTTTGAAGATGTGGCTACATCTCGAGATGTAGCCACATCTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-261s1c1
Sequence:CCGGCGCCCTGTATTACATTCTAATCTCGAGATTAGAATGTAATACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-1314s1c1
Sequence:CCGGGCTGATTCCATTAGATACATTCTCGAGAATGTATCTAATGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000749.2-784s1c1
Sequence:CCGGCCTATCCCTTTATCACGTATTCTCGAGAATACGTGATAAAGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-988s21c1
Sequence:CCGGCATCGTCTTCCAAAGTCATTCCTCGAGGAATGACTTTGGAAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-1371s21c1
Sequence:CCGGGTAGTACAAGACTGGAAATTTCTCGAGAAATTTCCAGTCTTGTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000749.3-1638s21c1
Sequence:CCGGATGGGAGAAACTCTGGTAAATCTCGAGATTTACCAGAGTTTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-398s21c1
Sequence:CCGGACGCTGGAATCCTGATGATTACTCGAGTAATCATCAGGATTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-261s21c1
Sequence:CCGGCGCCCTGTATTACATTCTAATCTCGAGATTAGAATGTAATACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000749.3-517s21c1
Sequence:CCGGTGACCAAGGTCATCGTGAAATCTCGAGATTTCACGATGACCTTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks