EMAIL THIS PAGE TO A FRIEND

CHRNB4

cholinergic receptor, nicotinic, beta 4 (neuronal)

Gene ID:
Mouse(108015) cholinergic receptor, nicotinic, beta polypeptide 4
Rat(25103) cholinergic receptor, nicotinic, beta 4 (neuronal)
chicken(395613) cholinergic receptor, nicotinic, beta 4 (neuronal)
dog(482110) cholinergic receptor, nicotinic, beta 4 (neuronal)
cow(282181) cholinergic receptor, nicotinic, beta 4
domestic guinea pig(100721209) cholinergic receptor, nicotinic, beta 4 (neuronal)
naked mole-rat(101700564) cholinergic receptor, nicotinic, beta 4 (neuronal)
sheep(101123499) cholinergic receptor, nicotinic, beta 4 (neuronal)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305954 ANTI-CHRNB4(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000750 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000750 Rosetta Predictions human pricing
NM_052806 Rosetta Predictions rat pricing
NM_148944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211522 predicted 473
2 SASI_Hs01_00211523 predicted 1488
3 SASI_Hs01_00211524 predicted 761
4 SASI_Hs02_00303182 predicted 399
5 SASI_Hs01_00211525 predicted 442
6 SASI_Hs02_00303183 predicted 734
7 SASI_Hs01_00211526 predicted 1128
8 SASI_Hs01_00211528 predicted 566
9 SASI_Hs01_00211529 predicted 1629
10 SASI_Hs01_00211530 predicted 647
11 SASI_Hs01_00211527 predicted 313
12 SASI_Hs01_00211531 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265602 predicted 926
2 SASI_Rn02_00265603 predicted 486
3 SASI_Rn01_00114049 predicted 695
4 SASI_Rn02_00265604 predicted 359
5 SASI_Rn02_00265605 predicted 1089
6 SASI_Rn02_00265606 predicted 648
7 SASI_Rn02_00265607 predicted 1243
8 SASI_Rn02_00265608 predicted 1158
9 SASI_Rn02_00265609 predicted 640
10 SASI_Rn02_00265610 predicted 697
11 SASI_Rn01_00114044 predicted 258
12 SASI_Rn01_00114045 predicted 425
13 SASI_Rn01_00114046 predicted 599
14 SASI_Rn01_00114047 predicted 1354
15 SASI_Rn01_00114048 predicted 1568
16 SASI_Rn01_00114050 predicted 1224
17 SASI_Rn01_00114051 predicted 1638
18 SASI_Rn01_00114052 predicted 397
19 SASI_Rn01_00114053 predicted 1621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342759 predicted 1186
2 SASI_Mm02_00342760 predicted 242
3 SASI_Mm02_00342761 predicted 865
4 SASI_Mm02_00342762 predicted 1314
5 SASI_Mm02_00342763 predicted 1631
6 SASI_Mm02_00342764 predicted 769
7 SASI_Mm02_00342765 predicted 1203
8 SASI_Mm02_00342766 predicted 693
9 SASI_Mm02_00342767 predicted 925
10 SASI_Mm02_00342768 predicted 1623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000750
CHRNB4 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 4 (neuronal)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000750.3-636s21c1
Sequence:CCGGCCTATGACCACACGGAGATAGCTCGAGCTATCTCCGTGTGGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000750.3-573s21c1
Sequence:CCGGAGATTGAGGTGAAGTACTTTCCTCGAGGAAAGTACTTCACCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-783s1c1
Sequence:CCGGCGTGACTTACGACTTCATCATCTCGAGATGATGAAGTCGTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-1428s1c1
Sequence:CCGGGCACATGAAGAATGACGATGACTCGAGTCATCGTCATTCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-1259s1c1
Sequence:CCGGCCAACTTCTATGGGAACTCCACTCGAGTGGAGTTCCCATAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-456s1c1
Sequence:CCGGGCCTGACATCGTGCTTTACAACTCGAGTTGTAAAGCACGATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000750
CHRNB4 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 4 (neuronal)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000750.3-636s21c1
Sequence:CCGGCCTATGACCACACGGAGATAGCTCGAGCTATCTCCGTGTGGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000750.3-573s21c1
Sequence:CCGGAGATTGAGGTGAAGTACTTTCCTCGAGGAAAGTACTTCACCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-783s1c1
Sequence:CCGGCGTGACTTACGACTTCATCATCTCGAGATGATGAAGTCGTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-1428s1c1
Sequence:CCGGGCACATGAAGAATGACGATGACTCGAGTCATCGTCATTCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-1259s1c1
Sequence:CCGGCCAACTTCTATGGGAACTCCACTCGAGTGGAGTTCCCATAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-456s1c1
Sequence:CCGGGCCTGACATCGTGCTTTACAACTCGAGTTGTAAAGCACGATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000750
CHRNB4 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 4 (neuronal)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000750.3-636s21c1
Sequence:CCGGCCTATGACCACACGGAGATAGCTCGAGCTATCTCCGTGTGGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000750.3-573s21c1
Sequence:CCGGAGATTGAGGTGAAGTACTTTCCTCGAGGAAAGTACTTCACCTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-783s1c1
Sequence:CCGGCGTGACTTACGACTTCATCATCTCGAGATGATGAAGTCGTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-1428s1c1
Sequence:CCGGGCACATGAAGAATGACGATGACTCGAGTCATCGTCATTCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-1259s1c1
Sequence:CCGGCCAACTTCTATGGGAACTCCACTCGAGTGGAGTTCCCATAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000750.1-456s1c1
Sequence:CCGGGCCTGACATCGTGCTTTACAACTCGAGTTGTAAAGCACGATGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148944
CHRNB4 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 4 (neuronal)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1717s21c1
Sequence:CCGGCTCTGAATATCTTCGAGTAAGCTCGAGCTTACTCGAAGATATTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1624s21c1
Sequence:CCGGGCTAATGAGACCCTAAGTAAACTCGAGTTTACTTAGGGTCTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1886s21c1
Sequence:CCGGTAGATTCCCTGGCCGTCTTTCCTCGAGGAAAGACGGCCAGGGAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-913s1c1
Sequence:CCGGCATTGGCAAGTACCTCTTGTTCTCGAGAACAAGAGGTACTTGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-1178s1c1
Sequence:CCGGCCATCCAACCTCTATGGGAATCTCGAGATTCCCATAGAGGTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-412s1c1
Sequence:CCGGGTCTGTCTACACCAACGTGATCTCGAGATCACGTTGGTGTAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-274s1c1
Sequence:CCGGGAAACAGGAATGGACTGACTACTCGAGTAGTCAGTCCATTCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-562s1c1
Sequence:CCGGCCACACAGAGATTGACATGGTCTCGAGACCATGTCAATCTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148944
CHRNB4 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 4 (neuronal)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1717s21c1
Sequence:CCGGCTCTGAATATCTTCGAGTAAGCTCGAGCTTACTCGAAGATATTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1624s21c1
Sequence:CCGGGCTAATGAGACCCTAAGTAAACTCGAGTTTACTTAGGGTCTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1886s21c1
Sequence:CCGGTAGATTCCCTGGCCGTCTTTCCTCGAGGAAAGACGGCCAGGGAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-913s1c1
Sequence:CCGGCATTGGCAAGTACCTCTTGTTCTCGAGAACAAGAGGTACTTGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-1178s1c1
Sequence:CCGGCCATCCAACCTCTATGGGAATCTCGAGATTCCCATAGAGGTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-412s1c1
Sequence:CCGGGTCTGTCTACACCAACGTGATCTCGAGATCACGTTGGTGTAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-274s1c1
Sequence:CCGGGAAACAGGAATGGACTGACTACTCGAGTAGTCAGTCCATTCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-562s1c1
Sequence:CCGGCCACACAGAGATTGACATGGTCTCGAGACCATGTCAATCTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148944
CHRNB4 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 4 (neuronal)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1717s21c1
Sequence:CCGGCTCTGAATATCTTCGAGTAAGCTCGAGCTTACTCGAAGATATTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1624s21c1
Sequence:CCGGGCTAATGAGACCCTAAGTAAACTCGAGTTTACTTAGGGTCTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148944.4-1886s21c1
Sequence:CCGGTAGATTCCCTGGCCGTCTTTCCTCGAGGAAAGACGGCCAGGGAATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-913s1c1
Sequence:CCGGCATTGGCAAGTACCTCTTGTTCTCGAGAACAAGAGGTACTTGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-1178s1c1
Sequence:CCGGCCATCCAACCTCTATGGGAATCTCGAGATTCCCATAGAGGTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-412s1c1
Sequence:CCGGGTCTGTCTACACCAACGTGATCTCGAGATCACGTTGGTGTAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-274s1c1
Sequence:CCGGGAAACAGGAATGGACTGACTACTCGAGTAGTCAGTCCATTCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148944.1-562s1c1
Sequence:CCGGCCACACAGAGATTGACATGGTCTCGAGACCATGTCAATCTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks