EMAIL THIS PAGE TO A FRIEND

CHRND

cholinergic receptor, nicotinic, delta (muscle)

Synonyms: ACHRD CMS2A FCCMS SCCMS
UniProtKB ID: Q07001, A8K661, B4DT92, Q52LH4
Gene ID:
Human(1144) Summary: The acetylcholine receptor of muscle has 5 subunits of 4 different types: 2 alpha and 1 each of beta, gamma and delta subunits. After acetylcholine binding, the receptor undergoes an extensive conformation change that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. Defects in this gene are a cause of multiple pterygium syndrome lethal type (MUPSL), congenital myasthenic syndrome slow-channel type (SCCMS), and congenital myasthenic syndrome fast-channel type (FCCMS). Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(11447) cholinergic receptor, nicotinic, delta polypeptide
Rat(54240) cholinergic receptor, nicotinic, delta (muscle)
sheep(101102707) cholinergic receptor, nicotinic, delta (muscle)
Domestic Rabbit(100352617) cholinergic receptor, nicotinic, delta (muscle)
naked mole-rat(101705768) cholinergic receptor, nicotinic, delta (muscle)
domestic guinea pig(100733810) cholinergic receptor, nicotinic, delta (muscle)
Zebrafish(404273) cholinergic receptor, nicotinic, delta polypeptide
cow(281687) cholinergic receptor, nicotinic, delta
domestic cat(101098322) cholinergic receptor, nicotinic, delta (muscle)
chicken(424940) cholinergic receptor, nicotinic, delta
dog(486162) cholinergic receptor, nicotinic, delta (muscle)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV13022 Anti-CHRND antibody produced in rabbit affinity isolated antibody canine, rat, human, pig, rabbit, bovine, zebrafish, guinea pig
immunohistochemistry, western blot pricing
SAB1410190 Anti-CHRND antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0001144M1 Monoclonal Anti-CHRND antibody produced in mouse clone 2B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000751 Rosetta Predictions human pricing
NM_019298 Rosetta Predictions rat pricing
NM_021600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159063 predicted 534
2 SASI_Hs01_00159064 predicted 214
3 SASI_Hs01_00159065 predicted 211
4 SASI_Hs01_00159066 predicted 1356
5 SASI_Hs01_00159067 predicted 1192
6 SASI_Hs01_00159068 predicted 1326
7 SASI_Hs01_00159069 predicted 496
8 SASI_Hs01_00159070 predicted 215
9 SASI_Hs01_00159071 predicted 822
10 SASI_Hs01_00159072 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078465 predicted 494
2 SASI_Rn01_00078466 predicted 1318
3 SASI_Rn01_00078467 predicted 1010
4 SASI_Rn02_00262257 predicted 819
5 SASI_Rn01_00078468 predicted 232
6 SASI_Rn01_00078469 predicted 360
7 SASI_Rn01_00078470 predicted 380
8 SASI_Rn01_00078471 predicted 1455
9 SASI_Rn01_00078472 predicted 343
10 SASI_Rn01_00078473 predicted 527
11 SASI_Rn01_00078474 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082624 predicted 1372
2 SASI_Mm01_00082626 predicted 657
3 SASI_Mm01_00082627 predicted 869
4 SASI_Mm01_00082628 predicted 579
5 SASI_Mm01_00082629 predicted 279
6 SASI_Mm01_00082630 predicted 305
7 SASI_Mm01_00082631 predicted 782
8 SASI_Mm01_00082632 predicted 1498
9 SASI_Mm01_00082633 predicted 422
10 SASI_Mm02_00326359 predicted 1636
11 SASI_Mm01_00082625 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000751
CHRND MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, delta (muscle)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-175s1c1
Sequence:CCGGCCTCACACTCTCCAACCTCATCTCGAGATGAGGTTGGAGAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-502s1c1
Sequence:CCGGCCTCAAGTTCAGTTCCCTCAACTCGAGTTGAGGGAACTGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-587s1c1
Sequence:CCGGGTGGAGTGGATCATCATTGATCTCGAGATCAATGATGATCCACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-1192s1c1
Sequence:CCGGCAGTGACCTCATGTTCGAGAACTCGAGTTCTCGAACATGAGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-97s1c1
Sequence:CCGGCCTGTTTCAAGAGAAGGGCTACTCGAGTAGCCCTTCTCTTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-1465s21c1
Sequence:CCGGGATCTTCCTGCAGGGCGTTTACTCGAGTAAACGCCCTGCAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-1346s21c1
Sequence:CCGGCACATGAGGGACCAGAACAATCTCGAGATTGTTCTGGTCCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-257s21c1
Sequence:CCGGGACAACCGGCTGAAGTGGAATCTCGAGATTCCACTTCAGCCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000751
CHRND MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, delta (muscle)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-175s1c1
Sequence:CCGGCCTCACACTCTCCAACCTCATCTCGAGATGAGGTTGGAGAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-502s1c1
Sequence:CCGGCCTCAAGTTCAGTTCCCTCAACTCGAGTTGAGGGAACTGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-587s1c1
Sequence:CCGGGTGGAGTGGATCATCATTGATCTCGAGATCAATGATGATCCACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-1192s1c1
Sequence:CCGGCAGTGACCTCATGTTCGAGAACTCGAGTTCTCGAACATGAGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-97s1c1
Sequence:CCGGCCTGTTTCAAGAGAAGGGCTACTCGAGTAGCCCTTCTCTTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-1465s21c1
Sequence:CCGGGATCTTCCTGCAGGGCGTTTACTCGAGTAAACGCCCTGCAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-1346s21c1
Sequence:CCGGCACATGAGGGACCAGAACAATCTCGAGATTGTTCTGGTCCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-257s21c1
Sequence:CCGGGACAACCGGCTGAAGTGGAATCTCGAGATTCCACTTCAGCCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000751
CHRND MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, delta (muscle)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-175s1c1
Sequence:CCGGCCTCACACTCTCCAACCTCATCTCGAGATGAGGTTGGAGAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-502s1c1
Sequence:CCGGCCTCAAGTTCAGTTCCCTCAACTCGAGTTGAGGGAACTGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-587s1c1
Sequence:CCGGGTGGAGTGGATCATCATTGATCTCGAGATCAATGATGATCCACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-1192s1c1
Sequence:CCGGCAGTGACCTCATGTTCGAGAACTCGAGTTCTCGAACATGAGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000751.1-97s1c1
Sequence:CCGGCCTGTTTCAAGAGAAGGGCTACTCGAGTAGCCCTTCTCTTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-1465s21c1
Sequence:CCGGGATCTTCCTGCAGGGCGTTTACTCGAGTAAACGCCCTGCAGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-1346s21c1
Sequence:CCGGCACATGAGGGACCAGAACAATCTCGAGATTGTTCTGGTCCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000751.1-257s21c1
Sequence:CCGGGACAACCGGCTGAAGTGGAATCTCGAGATTCCACTTCAGCCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021600
CHRND MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, delta (muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021600.1-1742s1c1
Sequence:CCGGCCGGAAACAATTCCTTTCTAACTCGAGTTAGAAAGGAATTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-759s1c1
Sequence:CCGGCCACCAAGATGTCACCTTCTACTCGAGTAGAAGGTGACATCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-156s1c1
Sequence:CCGGCCTATTCAATGAGAAGGGCTACTCGAGTAGCCCTTCTCATTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-1387s1c1
Sequence:CCGGGCAAACTTCATCGTCAACCATCTCGAGATGGTTGACGATGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-432s1c1
Sequence:CCGGCCAGATTTCTTATGCCTGCAACTCGAGTTGCAGGCATAAGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021600
CHRND MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, delta (muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021600.1-1742s1c1
Sequence:CCGGCCGGAAACAATTCCTTTCTAACTCGAGTTAGAAAGGAATTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-759s1c1
Sequence:CCGGCCACCAAGATGTCACCTTCTACTCGAGTAGAAGGTGACATCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-156s1c1
Sequence:CCGGCCTATTCAATGAGAAGGGCTACTCGAGTAGCCCTTCTCATTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-1387s1c1
Sequence:CCGGGCAAACTTCATCGTCAACCATCTCGAGATGGTTGACGATGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-432s1c1
Sequence:CCGGCCAGATTTCTTATGCCTGCAACTCGAGTTGCAGGCATAAGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021600
CHRND MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, delta (muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021600.1-1742s1c1
Sequence:CCGGCCGGAAACAATTCCTTTCTAACTCGAGTTAGAAAGGAATTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-759s1c1
Sequence:CCGGCCACCAAGATGTCACCTTCTACTCGAGTAGAAGGTGACATCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-156s1c1
Sequence:CCGGCCTATTCAATGAGAAGGGCTACTCGAGTAGCCCTTCTCATTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-1387s1c1
Sequence:CCGGGCAAACTTCATCGTCAACCATCTCGAGATGGTTGACGATGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021600.1-432s1c1
Sequence:CCGGCCAGATTTCTTATGCCTGCAACTCGAGTTGCAGGCATAAGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks