EMAIL THIS PAGE TO A FRIEND

CHRNE

cholinergic receptor, nicotinic, epsilon (muscle)

73 Gene Product Result for
Synonyms: ACHRE CMS1D CMS1E CMS2A FCCMS SCCMS
UniProtKB ID: Q04844, D3DTK6
Gene ID:
Human(1145) Summary: Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]
Mouse(11448) cholinergic receptor, nicotinic, epsilon polypeptide
Rat(29422) cholinergic receptor, nicotinic, epsilon (muscle)
Zebrafish(445315) cholinergic receptor, nicotinic, epsilon
cow(281688) cholinergic receptor, nicotinic, epsilon (muscle)
domestic cat(101092560) cholinergic receptor, nicotinic, epsilon (muscle)
dog(479471) cholinergic receptor, nicotinic, epsilon (muscle)
domestic guinea pig(100722702) cholinergic receptor, nicotinic, epsilon (muscle)
naked mole-rat(101716770) cholinergic receptor, nicotinic, epsilon (muscle)
sheep(101110155) cholinergic receptor, nicotinic, epsilon (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139161 MISSION® esiRNA esiRNA human CHRNE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000080 Rosetta Predictions human pricing
NM_017194 Rosetta Predictions rat pricing
NM_009603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301818 predicted 1671
2 SASI_Hs01_00164797 predicted 1364
3 SASI_Hs01_00164798 predicted 1721
4 SASI_Hs02_00301819 predicted 1596
5 SASI_Hs01_00164801 predicted 602
6 SASI_Hs01_00164802 predicted 1693
7 SASI_Hs01_00164804 predicted 1799
8 SASI_Hs02_00301820 predicted 1644
9 SASI_Hs02_00301821 predicted 1808
10 SASI_Hs02_00301822 predicted 221
11 SASI_Hs01_00164799 predicted 592
12 SASI_Hs01_00164800 predicted 699
13 SASI_Hs01_00164803 predicted 522
14 SASI_Hs01_00164805 predicted 1484
15 SASI_Hs01_00164806 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261546 predicted 711
2 SASI_Rn01_00040905 predicted 643
3 SASI_Rn01_00040908 predicted 556
4 SASI_Rn02_00261547 predicted 212
5 SASI_Rn01_00040909 predicted 417
6 SASI_Rn01_00040910 predicted 406
7 SASI_Rn01_00040911 predicted 1013
8 SASI_Rn01_00040912 predicted 284
9 SASI_Rn01_00040913 predicted 567
10 SASI_Rn01_00040914 predicted 670
11 SASI_Rn01_00040906 predicted 1331
12 SASI_Rn01_00040907 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181357 predicted 1295
2 SASI_Mm01_00181358 predicted 249
3 SASI_Mm01_00181359 predicted 693
4 SASI_Mm01_00181360 predicted 620
5 SASI_Mm01_00181361 predicted 660
6 SASI_Mm01_00181362 predicted 583
7 SASI_Mm01_00181363 predicted 387
8 SASI_Mm01_00181364 predicted 492
9 SASI_Mm01_00181365 predicted 933
10 SASI_Mm01_00181366 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000080
CHRNE MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, epsilon (muscle)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-1493s21c1
Sequence:CCGGGCTCGCACCGACTTCAATTTCCTCGAGGAAATTGAAGTCGGTGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-487s21c1
Sequence:CCGGGGCAGAACTGTTCGCTTATTTCTCGAGAAATAAGCGAACAGTTCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-74s21c1
Sequence:CCGGGAACGAGGAACTGCGTCTTTACTCGAGTAAAGACGCAGTTCCTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-955s1c1
Sequence:CCGGCCACGCTCATTGTCATGAATTCTCGAGAATTCATGACAATGAGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-566s1c1
Sequence:CCGGCGGCAAGACCATCAACAAGATCTCGAGATCTTGTTGATGGTCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-229s1c1
Sequence:CCGGGCGTCTGGATTGGAATCGATTCTCGAGAATCGATTCCAATCCAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-251s1c1
Sequence:CCGGGCAGGATTACCGACTCAACTACTCGAGTAGTTGAGTCGGTAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-1440s1c1
Sequence:CCGGGCCTACTTCAACCGAGTGCCTCTCGAGAGGCACTCGGTTGAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000080
CHRNE MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, epsilon (muscle)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-1493s21c1
Sequence:CCGGGCTCGCACCGACTTCAATTTCCTCGAGGAAATTGAAGTCGGTGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-487s21c1
Sequence:CCGGGGCAGAACTGTTCGCTTATTTCTCGAGAAATAAGCGAACAGTTCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-74s21c1
Sequence:CCGGGAACGAGGAACTGCGTCTTTACTCGAGTAAAGACGCAGTTCCTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-955s1c1
Sequence:CCGGCCACGCTCATTGTCATGAATTCTCGAGAATTCATGACAATGAGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-566s1c1
Sequence:CCGGCGGCAAGACCATCAACAAGATCTCGAGATCTTGTTGATGGTCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-229s1c1
Sequence:CCGGGCGTCTGGATTGGAATCGATTCTCGAGAATCGATTCCAATCCAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-251s1c1
Sequence:CCGGGCAGGATTACCGACTCAACTACTCGAGTAGTTGAGTCGGTAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-1440s1c1
Sequence:CCGGGCCTACTTCAACCGAGTGCCTCTCGAGAGGCACTCGGTTGAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000080
CHRNE MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, epsilon (muscle)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-1493s21c1
Sequence:CCGGGCTCGCACCGACTTCAATTTCCTCGAGGAAATTGAAGTCGGTGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-487s21c1
Sequence:CCGGGGCAGAACTGTTCGCTTATTTCTCGAGAAATAAGCGAACAGTTCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000080.2-74s21c1
Sequence:CCGGGAACGAGGAACTGCGTCTTTACTCGAGTAAAGACGCAGTTCCTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-955s1c1
Sequence:CCGGCCACGCTCATTGTCATGAATTCTCGAGAATTCATGACAATGAGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-566s1c1
Sequence:CCGGCGGCAAGACCATCAACAAGATCTCGAGATCTTGTTGATGGTCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-229s1c1
Sequence:CCGGGCGTCTGGATTGGAATCGATTCTCGAGAATCGATTCCAATCCAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-251s1c1
Sequence:CCGGGCAGGATTACCGACTCAACTACTCGAGTAGTTGAGTCGGTAATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000080.2-1440s1c1
Sequence:CCGGGCCTACTTCAACCGAGTGCCTCTCGAGAGGCACTCGGTTGAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009603
CHRNE MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, epsilon (muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-574s1c1
Sequence:CCGGCGGCAATACCATCAACAAGATCTCGAGATCTTGTTGATGGTATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-962s1c1
Sequence:CCGGGCCACGCTCATTGTCATGAATCTCGAGATTCATGACAATGAGCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-107s1c1
Sequence:CCGGCATCTCTTCGACAATTATGATCTCGAGATCATAATTGTCGAAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-863s1c1
Sequence:CCGGGCCCAGACTGTCTTCTTGTTTCTCGAGAAACAAGAAGACAGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-392s1c1
Sequence:CCGGGACAGCAATGTTCTAGTCTATCTCGAGATAGACTAGAACATTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009603
CHRNE MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, epsilon (muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-574s1c1
Sequence:CCGGCGGCAATACCATCAACAAGATCTCGAGATCTTGTTGATGGTATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-962s1c1
Sequence:CCGGGCCACGCTCATTGTCATGAATCTCGAGATTCATGACAATGAGCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-107s1c1
Sequence:CCGGCATCTCTTCGACAATTATGATCTCGAGATCATAATTGTCGAAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-863s1c1
Sequence:CCGGGCCCAGACTGTCTTCTTGTTTCTCGAGAAACAAGAAGACAGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-392s1c1
Sequence:CCGGGACAGCAATGTTCTAGTCTATCTCGAGATAGACTAGAACATTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009603
CHRNE MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, epsilon (muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-574s1c1
Sequence:CCGGCGGCAATACCATCAACAAGATCTCGAGATCTTGTTGATGGTATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-962s1c1
Sequence:CCGGGCCACGCTCATTGTCATGAATCTCGAGATTCATGACAATGAGCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-107s1c1
Sequence:CCGGCATCTCTTCGACAATTATGATCTCGAGATCATAATTGTCGAAGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-863s1c1
Sequence:CCGGGCCCAGACTGTCTTCTTGTTTCTCGAGAAACAAGAAGACAGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009603.1-392s1c1
Sequence:CCGGGACAGCAATGTTCTAGTCTATCTCGAGATAGACTAGAACATTGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)