EMAIL THIS PAGE TO A FRIEND

CHRNG

cholinergic receptor, nicotinic, gamma (muscle)

49 Gene Product Result for
Synonyms: ACHRG
UniProtKB ID: P07510, B3KWM8, Q53RG2
Gene ID:
Human(1146) Summary: The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]
Mouse(11449) cholinergic receptor, nicotinic, gamma polypeptide
Rat(25753) cholinergic receptor, nicotinic, gamma (muscle)
sheep(101102965) cholinergic receptor, nicotinic, gamma (muscle)
naked mole-rat(101706620) cholinergic receptor, nicotinic, gamma (muscle)
domestic guinea pig(100733530) cholinergic receptor, nicotinic, gamma (muscle)
Zebrafish(325080) cholinergic receptor, nicotinic, gamma
cow(281689) cholinergic receptor, nicotinic, gamma (muscle)
domestic cat(101098733) cholinergic receptor, nicotinic, gamma (muscle)
dog(486163) cholinergic receptor, nicotinic, gamma (muscle)
chicken(429151) cholinergic receptor, nicotinic, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AG318 Acetylcholine Receptor-γ, control peptide for AB5936 100 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005199 Rosetta Predictions human pricing
NM_019145 Rosetta Predictions rat pricing
NM_009604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155560 predicted 541
2 SASI_Hs02_00339167 predicted 1383
3 SASI_Hs01_00155562 predicted 1648
4 SASI_Hs02_00339168 predicted 1529
5 SASI_Hs01_00155563 predicted 1599
6 SASI_Hs01_00155564 predicted 1869
7 SASI_Hs01_00155565 predicted 991
8 SASI_Hs01_00155566 predicted 1613
9 SASI_Hs01_00155567 predicted 1877
10 SASI_Hs02_00339169 predicted 1277
11 SASI_Hs01_00155559 predicted 990
12 SASI_Hs01_00155561 predicted 510
13 SASI_Hs01_00155568 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082976 predicted 407
2 SASI_Rn01_00082977 predicted 1376
3 SASI_Rn01_00082978 predicted 345
4 SASI_Rn01_00082979 predicted 469
5 SASI_Rn01_00082980 predicted 261
6 SASI_Rn01_00082981 predicted 1302
7 SASI_Rn01_00082982 predicted 498
8 SASI_Rn01_00082983 predicted 446
9 SASI_Rn01_00082984 predicted 1454
10 SASI_Rn01_00082985 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316529 predicted 1605
2 SASI_Mm01_00051113 predicted 229
3 SASI_Mm01_00051114 predicted 292
4 SASI_Mm01_00051115 predicted 1247
5 SASI_Mm01_00051116 predicted 1228
6 SASI_Mm02_00316530 predicted 1605
7 SASI_Mm01_00051117 predicted 372
8 SASI_Mm01_00051120 predicted 1378
9 SASI_Mm01_00051119 predicted 248
10 SASI_Mm02_00316531 predicted 1258
11 SASI_Mm01_00051118 predicted 835
12 SASI_Mm01_00051121 predicted 532
13 SASI_Mm01_00051122 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005199
CHRNG MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, gamma (muscle)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-1368s1c1
Sequence:CCGGCCAGCAGAGTCACTTTGACAACTCGAGTTGTCAAAGTGACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-171s1c1
Sequence:CCGGCCTGAAGCTAACCCTCACCAACTCGAGTTGGTGAGGGTTAGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-955s1c1
Sequence:CCGGACCATCCTCATTGTCGTGAATCTCGAGATTCACGACAATGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-519s1c1
Sequence:CCGGCCAGACTTACAGCACCAATGACTCGAGTCATTGGTGCTGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005199.4-1654s21c1
Sequence:CCGGAGGTCCTAAGTGTGCTCTTTGCTCGAGCAAAGAGCACACTTAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005199.4-160s21c1
Sequence:CCGGGACTCGGATGTGGTCAATGTCCTCGAGGACATTGACCACATCCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005199
CHRNG MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, gamma (muscle)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-1368s1c1
Sequence:CCGGCCAGCAGAGTCACTTTGACAACTCGAGTTGTCAAAGTGACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-171s1c1
Sequence:CCGGCCTGAAGCTAACCCTCACCAACTCGAGTTGGTGAGGGTTAGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-955s1c1
Sequence:CCGGACCATCCTCATTGTCGTGAATCTCGAGATTCACGACAATGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-519s1c1
Sequence:CCGGCCAGACTTACAGCACCAATGACTCGAGTCATTGGTGCTGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005199.4-1654s21c1
Sequence:CCGGAGGTCCTAAGTGTGCTCTTTGCTCGAGCAAAGAGCACACTTAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005199.4-160s21c1
Sequence:CCGGGACTCGGATGTGGTCAATGTCCTCGAGGACATTGACCACATCCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005199
CHRNG MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, gamma (muscle)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-1368s1c1
Sequence:CCGGCCAGCAGAGTCACTTTGACAACTCGAGTTGTCAAAGTGACTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-171s1c1
Sequence:CCGGCCTGAAGCTAACCCTCACCAACTCGAGTTGGTGAGGGTTAGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-955s1c1
Sequence:CCGGACCATCCTCATTGTCGTGAATCTCGAGATTCACGACAATGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005199.3-519s1c1
Sequence:CCGGCCAGACTTACAGCACCAATGACTCGAGTCATTGGTGCTGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005199.4-1654s21c1
Sequence:CCGGAGGTCCTAAGTGTGCTCTTTGCTCGAGCAAAGAGCACACTTAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005199.4-160s21c1
Sequence:CCGGGACTCGGATGTGGTCAATGTCCTCGAGGACATTGACCACATCCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009604
CHRNG MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, gamma (muscle)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-616s1c1
Sequence:CCGGGCAAGCCATTGAGTGGATCTTCTCGAGAAGATCCACTCAATGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009604.2-1658s1c1
Sequence:CCGGCCATGCTGTTTGTAGAGCTGTCTCGAGACAGCTCTACAAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-1286s1c1
Sequence:CCGGCAGGCAGTATTGGAGAAGCTACTCGAGTAGCTTCTCCAATACTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-268s1c1
Sequence:CCGGCCTCACAACTAACGTCTGGATCTCGAGATCCAGACGTTAGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-223s1c1
Sequence:CCGGGCTTACCTTGACCAACCTCATCTCGAGATGAGGTTGGTCAAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009604.3-979s21c1
Sequence:CCGGACTCTGTGGTCGTGCTCAATGCTCGAGCATTGAGCACGACCACAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009604.3-151s21c1
Sequence:CCGGGCGACTCAGATGTGGTCAATGCTCGAGCATTGACCACATCTGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009604
CHRNG MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, gamma (muscle)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-616s1c1
Sequence:CCGGGCAAGCCATTGAGTGGATCTTCTCGAGAAGATCCACTCAATGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009604.2-1658s1c1
Sequence:CCGGCCATGCTGTTTGTAGAGCTGTCTCGAGACAGCTCTACAAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-1286s1c1
Sequence:CCGGCAGGCAGTATTGGAGAAGCTACTCGAGTAGCTTCTCCAATACTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-268s1c1
Sequence:CCGGCCTCACAACTAACGTCTGGATCTCGAGATCCAGACGTTAGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-223s1c1
Sequence:CCGGGCTTACCTTGACCAACCTCATCTCGAGATGAGGTTGGTCAAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009604.3-979s21c1
Sequence:CCGGACTCTGTGGTCGTGCTCAATGCTCGAGCATTGAGCACGACCACAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009604.3-151s21c1
Sequence:CCGGGCGACTCAGATGTGGTCAATGCTCGAGCATTGACCACATCTGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009604
CHRNG MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, gamma (muscle)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-616s1c1
Sequence:CCGGGCAAGCCATTGAGTGGATCTTCTCGAGAAGATCCACTCAATGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009604.2-1658s1c1
Sequence:CCGGCCATGCTGTTTGTAGAGCTGTCTCGAGACAGCTCTACAAACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-1286s1c1
Sequence:CCGGCAGGCAGTATTGGAGAAGCTACTCGAGTAGCTTCTCCAATACTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-268s1c1
Sequence:CCGGCCTCACAACTAACGTCTGGATCTCGAGATCCAGACGTTAGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009604.2-223s1c1
Sequence:CCGGGCTTACCTTGACCAACCTCATCTCGAGATGAGGTTGGTCAAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009604.3-979s21c1
Sequence:CCGGACTCTGTGGTCGTGCTCAATGCTCGAGCATTGAGCACGACCACAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009604.3-151s21c1
Sequence:CCGGGCGACTCAGATGTGGTCAATGCTCGAGCATTGACCACATCTGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks