EMAIL THIS PAGE TO A FRIEND

CHST10

carbohydrate sulfotransferase 10

61 Gene Product Result for
Synonyms: HNK-1ST HNK1ST
UniProtKB ID: O43529, Q53T18
Gene ID:
Human(9486) Summary: This protein encoded by this gene transfers sulfate to the C-3 hydroxyl of terminal glucuronic acid of protein- and lipid-linked oligosaccharides. This protein was first identified as a sulfotransferase that acts on the human natural killer-1 (HNK-1) glycan; HNK-1 is a carbohydrate involved in neurodevelopment and synaptic plasticity.[provided by RefSeq, Feb 2011]
Mouse(98388) carbohydrate sulfotransferase 10
Rat(140568) carbohydrate sulfotransferase 10
sheep(101110832) carbohydrate sulfotransferase 10
naked mole-rat(101701809) carbohydrate sulfotransferase 10
domestic guinea pig(100726665) carbohydrate sulfotransferase 10
Zebrafish(445322) carbohydrate sulfotransferase 10
dog(474555) carbohydrate sulfotransferase 10
cow(511215) carbohydrate sulfotransferase 10
Horse(100050281) carbohydrate sulfotransferase 10
domestic cat(101082996) carbohydrate sulfotransferase 10
chicken(395206) carbohydrate sulfotransferase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004854 Rosetta Predictions human pricing
NM_080397 Rosetta Predictions rat pricing
NM_145142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087738 predicted 926
2 SASI_Hs01_00087739 predicted 670
3 SASI_Hs01_00087741 predicted 1171
4 SASI_Hs01_00087742 predicted 696
5 SASI_Hs01_00087743 predicted 411
6 SASI_Hs01_00087744 predicted 1134
7 SASI_Hs01_00087745 predicted 646
8 SASI_Hs01_00087746 predicted 1436
9 SASI_Hs01_00087747 predicted 768
10 SASI_Hs02_00338456 predicted 1174
11 SASI_Hs01_00087740 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042877 predicted 873
2 SASI_Rn01_00042878 predicted 1278
3 SASI_Rn01_00042879 predicted 691
4 SASI_Rn01_00042881 predicted 356
5 SASI_Rn01_00042882 predicted 1001
6 SASI_Rn01_00042883 predicted 667
7 SASI_Rn01_00042884 predicted 650
8 SASI_Rn02_00267223 predicted 1076
9 SASI_Rn01_00042885 predicted 850
10 SASI_Rn02_00267224 predicted 833
11 SASI_Rn01_00042880 predicted 495
12 SASI_Rn01_00042886 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024348 predicted 656
2 SASI_Mm01_00024349 predicted 1021
3 SASI_Mm01_00024350 predicted 1446
4 SASI_Mm01_00024351 predicted 1172
5 SASI_Mm01_00024352 predicted 1461
6 SASI_Mm01_00024353 predicted 518
7 SASI_Mm01_00024354 predicted 413
8 SASI_Mm02_00340540 predicted 1545
9 SASI_Mm01_00024355 predicted 739
10 SASI_Mm01_00024357 predicted 1308
11 SASI_Mm01_00024356 predicted 1428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004854
CHST10 MISSION shRNA Bacterial Glycerol Stock
carbohydrate sulfotransferase 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-433s1c1
Sequence:CCGGCCAGATGTGTACAGTGCCAAACTCGAGTTTGGCACTGTACACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-736s1c1
Sequence:CCGGCAGTGGAAGAAAGTGCTGATTCTCGAGAATCAGCACTTTCTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-1242s1c1
Sequence:CCGGCCTGGTGTCATACCCGACTATCTCGAGATAGTCGGGTATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-859s1c1
Sequence:CCGGGAAATTCAGAAGCGATTGAAACTCGAGTTTCAATCGCTTCTGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-970s1c1
Sequence:CCGGCCTTGGTACAGGCATGAGATTCTCGAGAATCTCATGCCTGTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004854
CHST10 MISSION shRNA shRNA Plasmid DNA
carbohydrate sulfotransferase 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-433s1c1
Sequence:CCGGCCAGATGTGTACAGTGCCAAACTCGAGTTTGGCACTGTACACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-736s1c1
Sequence:CCGGCAGTGGAAGAAAGTGCTGATTCTCGAGAATCAGCACTTTCTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-1242s1c1
Sequence:CCGGCCTGGTGTCATACCCGACTATCTCGAGATAGTCGGGTATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-859s1c1
Sequence:CCGGGAAATTCAGAAGCGATTGAAACTCGAGTTTCAATCGCTTCTGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-970s1c1
Sequence:CCGGCCTTGGTACAGGCATGAGATTCTCGAGAATCTCATGCCTGTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004854
CHST10 MISSION shRNA Lentiviral Transduction Particles
carbohydrate sulfotransferase 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-433s1c1
Sequence:CCGGCCAGATGTGTACAGTGCCAAACTCGAGTTTGGCACTGTACACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-736s1c1
Sequence:CCGGCAGTGGAAGAAAGTGCTGATTCTCGAGAATCAGCACTTTCTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-1242s1c1
Sequence:CCGGCCTGGTGTCATACCCGACTATCTCGAGATAGTCGGGTATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-859s1c1
Sequence:CCGGGAAATTCAGAAGCGATTGAAACTCGAGTTTCAATCGCTTCTGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004854.2-970s1c1
Sequence:CCGGCCTTGGTACAGGCATGAGATTCTCGAGAATCTCATGCCTGTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145142
CHST10 MISSION shRNA Bacterial Glycerol Stock
carbohydrate sulfotransferase 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145142.2-1823s1c1
Sequence:CCGGCCCAGCACTTTCAAGAGAGATCTCGAGATCTCTCTTGAAAGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1316s1c1
Sequence:CCGGGCATAGACCATCTGGTGTCATCTCGAGATGACACCAGATGGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-766s1c1
Sequence:CCGGGTCTGTGACAAGCACAAGATTCTCGAGAATCTTGTGCTTGTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1470s1c1
Sequence:CCGGGAAACCAGATTTCTTGCTAAACTCGAGTTTAGCAAGAAATCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1054s1c1
Sequence:CCGGCCTTGGTACAGGCATGAGATACTCGAGTATCTCATGCCTGTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145142
CHST10 MISSION shRNA shRNA Plasmid DNA
carbohydrate sulfotransferase 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145142.2-1823s1c1
Sequence:CCGGCCCAGCACTTTCAAGAGAGATCTCGAGATCTCTCTTGAAAGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1316s1c1
Sequence:CCGGGCATAGACCATCTGGTGTCATCTCGAGATGACACCAGATGGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-766s1c1
Sequence:CCGGGTCTGTGACAAGCACAAGATTCTCGAGAATCTTGTGCTTGTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1470s1c1
Sequence:CCGGGAAACCAGATTTCTTGCTAAACTCGAGTTTAGCAAGAAATCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1054s1c1
Sequence:CCGGCCTTGGTACAGGCATGAGATACTCGAGTATCTCATGCCTGTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145142
CHST10 MISSION shRNA Lentiviral Transduction Particles
carbohydrate sulfotransferase 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145142.2-1823s1c1
Sequence:CCGGCCCAGCACTTTCAAGAGAGATCTCGAGATCTCTCTTGAAAGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1316s1c1
Sequence:CCGGGCATAGACCATCTGGTGTCATCTCGAGATGACACCAGATGGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-766s1c1
Sequence:CCGGGTCTGTGACAAGCACAAGATTCTCGAGAATCTTGTGCTTGTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1470s1c1
Sequence:CCGGGAAACCAGATTTCTTGCTAAACTCGAGTTTAGCAAGAAATCTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145142.2-1054s1c1
Sequence:CCGGCCTTGGTACAGGCATGAGATACTCGAGTATCTCATGCCTGTACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks