EMAIL THIS PAGE TO A FRIEND

CHST11

carbohydrate (chondroitin 4) sulfotransferase 11

77 Gene Product Result for
Synonyms: C4ST C4ST-1 C4ST1 HSA269537
UniProtKB ID: Q9NPF2, A8K4F8, Q9NXY6, Q9NY36
Gene ID:
Human(50515) Summary: The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving this gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(58250) carbohydrate sulfotransferase 11
Rat(314694) carbohydrate (chondroitin 4) sulfotransferase 11
Zebrafish(404232) carbohydrate (chondroitin 4) sulfotransferase 11
chicken(418081) carbohydrate (chondroitin 4) sulfotransferase 11
domestic cat(101085731) carbohydrate (chondroitin 4) sulfotransferase 11
cow(528860) carbohydrate (chondroitin 4) sulfotransferase 11
Horse(100067989) carbohydrate (chondroitin 4) sulfotransferase 11
dog(481299) carbohydrate (chondroitin 4) sulfotransferase 11
sheep(101113667) carbohydrate (chondroitin 4) sulfotransferase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018413 Rosetta Predictions human pricing
NM_001108079 Rosetta Predictions rat pricing
XM_235007 Rosetta Predictions rat pricing
NM_021439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210419 predicted 415
2 SASI_Hs01_00210420 predicted 1279
3 SASI_Hs01_00210421 predicted 1068
4 SASI_Hs01_00210422 predicted 1275
5 SASI_Hs01_00210423 predicted 1333
6 SASI_Hs01_00210424 predicted 1281
7 SASI_Hs01_00210425 predicted 570
8 SASI_Hs02_00351919 predicted 757
9 SASI_Hs01_00210426 predicted 1011
10 SASI_Hs01_00210427 predicted 1132
11 SASI_Hs01_00210428 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235144 predicted 423
2 SASI_Rn02_00235145 predicted 710
3 SASI_Rn02_00235146 predicted 873
4 SASI_Rn02_00235147 predicted 422
5 SASI_Rn02_00235148 predicted 429
6 SASI_Rn02_00235149 predicted 646
7 SASI_Rn02_00235150 predicted 697
8 SASI_Rn02_00235151 predicted 951
9 SASI_Rn02_00235152 predicted 502
10 SASI_Rn02_00235153 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154259 predicted 426
2 SASI_Rn01_00154260 predicted 1086
3 SASI_Rn01_00154261 predicted 718
4 SASI_Rn01_00154262 predicted 879
5 SASI_Rn01_00154263 predicted 428
6 SASI_Rn01_00154264 predicted 444
7 SASI_Rn01_00154265 predicted 648
8 SASI_Rn01_00154266 predicted 707
9 SASI_Rn01_00154267 predicted 960
10 SASI_Rn01_00154268 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065679 predicted 1207
2 SASI_Mm02_00326083 predicted 436
3 SASI_Mm01_00065680 predicted 877
4 SASI_Mm02_00326084 predicted 421
5 SASI_Mm01_00065681 predicted 1861
6 SASI_Mm01_00065682 predicted 1671
7 SASI_Mm01_00065683 predicted 714
8 SASI_Mm01_00065684 predicted 1723
9 SASI_Mm01_00065685 predicted 698
10 SASI_Mm01_00065686 predicted 953
11 SASI_Mm01_00065678 predicted 424
12 SASI_Mm01_00065687 predicted 1824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021439
CHST11 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 4) sulfotransferase 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021439.1-1581s1c1
Sequence:CCGGCGGCATGGTTAAGAATTATTTCTCGAGAAATAATTCTTAACCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-1075s1c1
Sequence:CCGGCGATGTCAAGTTCGAGGAGTTCTCGAGAACTCCTCGAACTTGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-445s1c1
Sequence:CCGGCGGATCCTTTATCTTGGTCATCTCGAGATGACCAAGATAAAGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-721s1c1
Sequence:CCGGCCACGAACTCATCTACTGCTACTCGAGTAGCAGTAGATGAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-1369s1c1
Sequence:CCGGCGAAGTCTACAAACTGGACTTCTCGAGAAGTCCAGTTTGTAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021439
CHST11 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 4) sulfotransferase 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021439.1-1581s1c1
Sequence:CCGGCGGCATGGTTAAGAATTATTTCTCGAGAAATAATTCTTAACCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-1075s1c1
Sequence:CCGGCGATGTCAAGTTCGAGGAGTTCTCGAGAACTCCTCGAACTTGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-445s1c1
Sequence:CCGGCGGATCCTTTATCTTGGTCATCTCGAGATGACCAAGATAAAGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-721s1c1
Sequence:CCGGCCACGAACTCATCTACTGCTACTCGAGTAGCAGTAGATGAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-1369s1c1
Sequence:CCGGCGAAGTCTACAAACTGGACTTCTCGAGAAGTCCAGTTTGTAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021439
CHST11 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 4) sulfotransferase 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021439.1-1581s1c1
Sequence:CCGGCGGCATGGTTAAGAATTATTTCTCGAGAAATAATTCTTAACCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-1075s1c1
Sequence:CCGGCGATGTCAAGTTCGAGGAGTTCTCGAGAACTCCTCGAACTTGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-445s1c1
Sequence:CCGGCGGATCCTTTATCTTGGTCATCTCGAGATGACCAAGATAAAGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-721s1c1
Sequence:CCGGCCACGAACTCATCTACTGCTACTCGAGTAGCAGTAGATGAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021439.1-1369s1c1
Sequence:CCGGCGAAGTCTACAAACTGGACTTCTCGAGAAGTCCAGTTTGTAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018413
VALIDATED
CHST11 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 4) sulfotransferase 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-1288s1c1
Sequence:CCGGCGAAGTCTACAAACTCGATTTCTCGAGAAATCGAGTTTGTAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018413.2-994s1c1
Sequence:CCGGCGATGTCAAATTCGAGGAGTTCTCGAGAACTCCTCGAATTTGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-1203s1c1
Sequence:CCGGCCTATGCAAAGTCTACGAGAACTCGAGTTCTCGTAGACTTTGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-377s1c1
Sequence:CCGGCTGGTCATCTTCTATTTCCAACTCGAGTTGGAAATAGAAGATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018413.2-475s1c1
Sequence:CCGGGCAGGAACTCTACAACCCAATCTCGAGATTGGGTTGTAGAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018413.4-802s21c1
Sequence:CCGGGAAATCAACCACCGCTTGAAACTCGAGTTTCAAGCGGTGGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018413.4-1135s21c1
Sequence:CCGGCTGGAAGAGGATTCTAATTACCTCGAGGTAATTAGAATCCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018413
VALIDATED
CHST11 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 4) sulfotransferase 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-1288s1c1
Sequence:CCGGCGAAGTCTACAAACTCGATTTCTCGAGAAATCGAGTTTGTAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018413.2-994s1c1
Sequence:CCGGCGATGTCAAATTCGAGGAGTTCTCGAGAACTCCTCGAATTTGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-1203s1c1
Sequence:CCGGCCTATGCAAAGTCTACGAGAACTCGAGTTCTCGTAGACTTTGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-377s1c1
Sequence:CCGGCTGGTCATCTTCTATTTCCAACTCGAGTTGGAAATAGAAGATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018413.2-475s1c1
Sequence:CCGGGCAGGAACTCTACAACCCAATCTCGAGATTGGGTTGTAGAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018413.4-802s21c1
Sequence:CCGGGAAATCAACCACCGCTTGAAACTCGAGTTTCAAGCGGTGGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018413.4-1135s21c1
Sequence:CCGGCTGGAAGAGGATTCTAATTACCTCGAGGTAATTAGAATCCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018413
VALIDATED
CHST11 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 4) sulfotransferase 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-1288s1c1
Sequence:CCGGCGAAGTCTACAAACTCGATTTCTCGAGAAATCGAGTTTGTAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018413.2-994s1c1
Sequence:CCGGCGATGTCAAATTCGAGGAGTTCTCGAGAACTCCTCGAATTTGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-1203s1c1
Sequence:CCGGCCTATGCAAAGTCTACGAGAACTCGAGTTCTCGTAGACTTTGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018413.2-377s1c1
Sequence:CCGGCTGGTCATCTTCTATTTCCAACTCGAGTTGGAAATAGAAGATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018413.2-475s1c1
Sequence:CCGGGCAGGAACTCTACAACCCAATCTCGAGATTGGGTTGTAGAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018413.4-802s21c1
Sequence:CCGGGAAATCAACCACCGCTTGAAACTCGAGTTTCAAGCGGTGGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018413.4-1135s21c1
Sequence:CCGGCTGGAAGAGGATTCTAATTACCTCGAGGTAATTAGAATCCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks