EMAIL THIS PAGE TO A FRIEND

CHST12

carbohydrate (chondroitin 4) sulfotransferase 12

84 Gene Product Result for
Synonyms: C4S-2 C4ST-2 C4ST2
UniProtKB ID: Q9NRB3, A4D1Z9, Q502W3, Q9NXY7
Gene ID:
Human(55501) Summary: The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin and desulfated dermatan sulfate. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. Alternatively spliced transcript variants differing only in their 5' UTRs have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(59031) carbohydrate sulfotransferase 12
Rat(304322) carbohydrate (chondroitin 4) sulfotransferase 12
sheep(101118845) carbohydrate (chondroitin 4) sulfotransferase 12
naked mole-rat(101700717) carbohydrate (chondroitin 4) sulfotransferase 12
chicken(416469) carbohydrate (chondroitin 4) sulfotransferase 12
cow(513030) carbohydrate (chondroitin 4) sulfotransferase 12
domestic cat(101086274) carbohydrate (chondroitin 4) sulfotransferase 12
dog(609635) carbohydrate (chondroitin 4) sulfotransferase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018641 Rosetta Predictions human pricing
NM_001037775 Rosetta Predictions rat pricing
NM_021528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352140 predicted 1010
2 SASI_Hs01_00082426 predicted 1315
3 SASI_Hs01_00082427 predicted 805
4 SASI_Hs01_00082428 predicted 758
5 SASI_Hs01_00082429 predicted 1007
6 SASI_Hs02_00352141 predicted 885
7 SASI_Hs01_00082433 predicted 1368
8 SASI_Hs01_00082434 predicted 1306
9 SASI_Hs01_00082435 predicted 820
10 SASI_Hs02_00352142 predicted 1357
11 SASI_Hs01_00082430 predicted 362
12 SASI_Hs01_00082431 predicted 350
13 SASI_Hs01_00082432 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112608 predicted 288
2 SASI_Rn01_00112609 predicted 728
3 SASI_Rn01_00112610 predicted 312
4 SASI_Rn01_00112611 predicted 260
5 SASI_Rn01_00112612 predicted 245
6 SASI_Rn01_00112613 predicted 1029
7 SASI_Rn02_00204570 predicted 1259
8 SASI_Rn01_00112614 predicted 981
9 SASI_Rn01_00112615 predicted 546
10 SASI_Rn01_00112616 predicted 402
11 SASI_Rn01_00112617 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326258 predicted 372
2 SASI_Mm01_00133444 predicted 951
3 SASI_Mm01_00133445 predicted 818
4 SASI_Mm01_00133446 predicted 393
5 SASI_Mm02_00326259 predicted 1557
6 SASI_Mm01_00133447 predicted 260
7 SASI_Mm02_00326260 predicted 868
8 SASI_Mm01_00133448 predicted 1065
9 SASI_Mm02_00326261 predicted 1536
10 SASI_Mm02_00326262 predicted 864
11 SASI_Mm01_00133442 predicted 1326
12 SASI_Mm01_00133443 predicted 232
13 SASI_Mm01_00133449 predicted 354
14 SASI_Mm01_00133450 predicted 842
15 SASI_Mm01_00133451 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018641
CHST12 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 4) sulfotransferase 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018641.3-1120s21c1
Sequence:CCGGGTGCCAGATCGACTACGACTTCTCGAGAAGTCGTAGTCGATCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018641.3-1531s21c1
Sequence:CCGGTCAGGTATTTAATACGAAATGCTCGAGCATTTCGTATTAAATACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018641.3-1490s21c1
Sequence:CCGGTTGAGTACTGTATCGATATTGCTCGAGCAATATCGATACAGTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-846s1c1
Sequence:CCGGGCTCAAGAAGTACACCAAGTTCTCGAGAACTTGGTGTACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-777s1c1
Sequence:CCGGCGCGCACCTGACCTTCAACAACTCGAGTTGTTGAAGGTCAGGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-342s1c1
Sequence:CCGGCGACGAGTTTCTGGACAAGTTCTCGAGAACTTGTCCAGAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-1338s1c1
Sequence:CCGGCGACTTTGTTCTCTTCGGCTACTCGAGTAGCCGAAGAGAACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-1314s1c1
Sequence:CCGGGCAGCTGTATAAACTCTACGACTCGAGTCGTAGAGTTTATACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018641
CHST12 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 4) sulfotransferase 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018641.3-1120s21c1
Sequence:CCGGGTGCCAGATCGACTACGACTTCTCGAGAAGTCGTAGTCGATCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018641.3-1531s21c1
Sequence:CCGGTCAGGTATTTAATACGAAATGCTCGAGCATTTCGTATTAAATACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018641.3-1490s21c1
Sequence:CCGGTTGAGTACTGTATCGATATTGCTCGAGCAATATCGATACAGTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-846s1c1
Sequence:CCGGGCTCAAGAAGTACACCAAGTTCTCGAGAACTTGGTGTACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-777s1c1
Sequence:CCGGCGCGCACCTGACCTTCAACAACTCGAGTTGTTGAAGGTCAGGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-342s1c1
Sequence:CCGGCGACGAGTTTCTGGACAAGTTCTCGAGAACTTGTCCAGAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-1338s1c1
Sequence:CCGGCGACTTTGTTCTCTTCGGCTACTCGAGTAGCCGAAGAGAACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-1314s1c1
Sequence:CCGGGCAGCTGTATAAACTCTACGACTCGAGTCGTAGAGTTTATACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018641
CHST12 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 4) sulfotransferase 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018641.3-1120s21c1
Sequence:CCGGGTGCCAGATCGACTACGACTTCTCGAGAAGTCGTAGTCGATCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018641.3-1531s21c1
Sequence:CCGGTCAGGTATTTAATACGAAATGCTCGAGCATTTCGTATTAAATACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018641.3-1490s21c1
Sequence:CCGGTTGAGTACTGTATCGATATTGCTCGAGCAATATCGATACAGTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-846s1c1
Sequence:CCGGGCTCAAGAAGTACACCAAGTTCTCGAGAACTTGGTGTACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-777s1c1
Sequence:CCGGCGCGCACCTGACCTTCAACAACTCGAGTTGTTGAAGGTCAGGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-342s1c1
Sequence:CCGGCGACGAGTTTCTGGACAAGTTCTCGAGAACTTGTCCAGAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-1338s1c1
Sequence:CCGGCGACTTTGTTCTCTTCGGCTACTCGAGTAGCCGAAGAGAACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018641.2-1314s1c1
Sequence:CCGGGCAGCTGTATAAACTCTACGACTCGAGTCGTAGAGTTTATACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021528
VALIDATED
CHST12 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 4) sulfotransferase 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021528.3-1344s21c1
Sequence:CCGGTGGAGGCAACAGCTCTATAAACTCGAGTTTATAGAGCTGTTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021528.3-1452s21c1
Sequence:CCGGCCCAACAAATTGAATGGCTGTCTCGAGACAGCCATTCAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-401s21c1
Sequence:CCGGCAACGACCTTTCCAGGAGAAACTCGAGTTTCTCCTGGAAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-818s21c1
Sequence:CCGGGCACCTCACCTTCAACAAGTTCTCGAGAACTTGTTGAAGGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-230s21c1
Sequence:CCGGGATCATTGTATATTGGGACAACTCGAGTTGTCCCAATATACAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-1433s1c1
Sequence:CCGGCCCAACAAATTGAATGGCTGTCTCGAGACAGCCATTCAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-799s1c1
Sequence:CCGGGCACCTCACCTTCAACAAGTTCTCGAGAACTTGTTGAAGGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021528.2-1325s1c1
Sequence:CCGGTGGAGGCAACAGCTCTATAAACTCGAGTTTATAGAGCTGTTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-211s1c1
Sequence:CCGGGATCATTGTATATTGGGACAACTCGAGTTGTCCCAATATACAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-382s1c1
Sequence:CCGGCAACGACCTTTCCAGGAGAAACTCGAGTTTCTCCTGGAAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021528
VALIDATED
CHST12 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 4) sulfotransferase 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021528.3-1344s21c1
Sequence:CCGGTGGAGGCAACAGCTCTATAAACTCGAGTTTATAGAGCTGTTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021528.3-1452s21c1
Sequence:CCGGCCCAACAAATTGAATGGCTGTCTCGAGACAGCCATTCAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-401s21c1
Sequence:CCGGCAACGACCTTTCCAGGAGAAACTCGAGTTTCTCCTGGAAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-818s21c1
Sequence:CCGGGCACCTCACCTTCAACAAGTTCTCGAGAACTTGTTGAAGGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-230s21c1
Sequence:CCGGGATCATTGTATATTGGGACAACTCGAGTTGTCCCAATATACAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-1433s1c1
Sequence:CCGGCCCAACAAATTGAATGGCTGTCTCGAGACAGCCATTCAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-799s1c1
Sequence:CCGGGCACCTCACCTTCAACAAGTTCTCGAGAACTTGTTGAAGGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021528.2-1325s1c1
Sequence:CCGGTGGAGGCAACAGCTCTATAAACTCGAGTTTATAGAGCTGTTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-211s1c1
Sequence:CCGGGATCATTGTATATTGGGACAACTCGAGTTGTCCCAATATACAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-382s1c1
Sequence:CCGGCAACGACCTTTCCAGGAGAAACTCGAGTTTCTCCTGGAAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021528
VALIDATED
CHST12 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 4) sulfotransferase 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021528.3-1344s21c1
Sequence:CCGGTGGAGGCAACAGCTCTATAAACTCGAGTTTATAGAGCTGTTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021528.3-1452s21c1
Sequence:CCGGCCCAACAAATTGAATGGCTGTCTCGAGACAGCCATTCAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-401s21c1
Sequence:CCGGCAACGACCTTTCCAGGAGAAACTCGAGTTTCTCCTGGAAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-818s21c1
Sequence:CCGGGCACCTCACCTTCAACAAGTTCTCGAGAACTTGTTGAAGGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021528.3-230s21c1
Sequence:CCGGGATCATTGTATATTGGGACAACTCGAGTTGTCCCAATATACAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-1433s1c1
Sequence:CCGGCCCAACAAATTGAATGGCTGTCTCGAGACAGCCATTCAATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-799s1c1
Sequence:CCGGGCACCTCACCTTCAACAAGTTCTCGAGAACTTGTTGAAGGTGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021528.2-1325s1c1
Sequence:CCGGTGGAGGCAACAGCTCTATAAACTCGAGTTTATAGAGCTGTTGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-211s1c1
Sequence:CCGGGATCATTGTATATTGGGACAACTCGAGTTGTCCCAATATACAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021528.2-382s1c1
Sequence:CCGGCAACGACCTTTCCAGGAGAAACTCGAGTTTCTCCTGGAAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks