EMAIL THIS PAGE TO A FRIEND

CHST13

carbohydrate (chondroitin 4) sulfotransferase 13

64 Gene Product Result for
Synonyms: C4ST3
UniProtKB ID: Q8NET6
Gene ID:
Human(166012) Summary: The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to the C4 hydroxyl of beta-1,4-linked N-acetylgalactosamine (GalNAc) flanked by glucuronic acid residue in chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. [provided by RefSeq, Aug 2011]
Mouse(71797) carbohydrate (chondroitin 4) sulfotransferase 13
Rat(500257) carbohydrate (chondroitin 4) sulfotransferase 13
chicken(416032) carbohydrate (chondroitin 4) sulfotransferase 13
dog(484618) carbohydrate (chondroitin 4) sulfotransferase 13
cow(523460) carbohydrate (chondroitin 4) sulfotransferase 13
domestic cat(101093089) carbohydrate (chondroitin 4) sulfotransferase 13
domestic guinea pig(100729380) carbohydrate (chondroitin 4) sulfotransferase 13
naked mole-rat(101703999) carbohydrate (chondroitin 4) sulfotransferase 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152889 Rosetta Predictions human pricing
XM_001076182 Rosetta Predictions rat pricing
XM_575606 Rosetta Predictions rat pricing
XM_978459 Rosetta Predictions mouse pricing
XM_994764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015857 predicted 206
2 SASI_Hs01_00015859 predicted 304
3 SASI_Hs01_00015860 predicted 289
4 SASI_Hs01_00015861 predicted 214
5 SASI_Hs01_00015862 predicted 1482
6 SASI_Hs01_00015863 predicted 249
7 SASI_Hs01_00015864 predicted 1372
8 SASI_Hs01_00015865 predicted 276
9 SASI_Hs01_00015866 predicted 397
10 SASI_Hs02_00366853 predicted 1504
11 SASI_Hs01_00015858 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352313 predicted 584
2 SASI_Rn02_00352314 predicted 613
3 SASI_Rn02_00352315 predicted 908
4 SASI_Rn02_00352316 predicted 903
5 SASI_Rn02_00352317 predicted 896
6 SASI_Rn02_00352318 predicted 559
7 SASI_Rn02_00352319 predicted 841
8 SASI_Rn02_00352320 predicted 926
9 SASI_Rn02_00352321 predicted 622
10 SASI_Rn02_00352322 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403903 predicted 452
2 SASI_Rn02_00403904 predicted 594
3 SASI_Rn02_00403905 predicted 488
4 SASI_Rn02_00403906 predicted 283
5 SASI_Rn02_00403907 predicted 245
6 SASI_Rn02_00403908 predicted 568
7 SASI_Rn02_00403909 predicted 582
8 SASI_Rn02_00403910 predicted 430
9 SASI_Rn02_00403911 predicted 415
10 SASI_Rn02_00403912 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243522 predicted 1080
2 SASI_Mm01_00243523 predicted 1233
3 SASI_Mm01_00243524 predicted 1151
4 SASI_Mm02_00446654 predicted 697
5 SASI_Mm02_00446655 predicted 1239
6 SASI_Mm01_00243526 predicted 1087
7 SASI_Mm01_00243527 predicted 1187
8 SASI_Mm01_00243528 predicted 919
9 SASI_Mm01_00243529 predicted 710
10 SASI_Mm01_00243531 predicted 752
11 SASI_Mm01_00243525 predicted 1267
12 SASI_Mm01_00243530 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451863 predicted 1078
2 SASI_Mm02_00451864 predicted 1235
3 SASI_Mm02_00451865 predicted 1157
4 SASI_Mm02_00451866 predicted 697
5 SASI_Mm02_00451867 predicted 1236
6 SASI_Mm02_00451868 predicted 1088
7 SASI_Mm02_00451869 predicted 1189
8 SASI_Mm02_00451870 predicted 923
9 SASI_Mm02_00451871 predicted 716
10 SASI_Mm02_00451872 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152889
CHST13 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 4) sulfotransferase 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-951s1c1
Sequence:CCGGGCGCCTCTTCGACCTCTACAACTCGAGTTGTAGAGGTCGAAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-537s1c1
Sequence:CCGGCCTGGCATCGGCTTACCGCAACTCGAGTTGCGGTAAGCCGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-960s1c1
Sequence:CCGGCGACCTCTACAAGATGGACTTCTCGAGAAGTCCATCTTGTAGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-663s1c1
Sequence:CCGGCGACGTGCGCTTCGCGGAGTTCTCGAGAACTCCGCGAAGCGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152889.1-1056s21c1
Sequence:CCGGGCAAGTGCCTTTCCGACAAGACTCGAGTCTTGTCGGAAAGGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152889.1-1297s21c1
Sequence:CCGGGATGGGCAAGGACTTGATAACCTCGAGGTTATCAAGTCCTTGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152889.1-164s21c1
Sequence:CCGGTCTATGACCTGGATCAGGACCCTCGAGGGTCCTGATCCAGGTCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152889
CHST13 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 4) sulfotransferase 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-951s1c1
Sequence:CCGGGCGCCTCTTCGACCTCTACAACTCGAGTTGTAGAGGTCGAAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-537s1c1
Sequence:CCGGCCTGGCATCGGCTTACCGCAACTCGAGTTGCGGTAAGCCGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-960s1c1
Sequence:CCGGCGACCTCTACAAGATGGACTTCTCGAGAAGTCCATCTTGTAGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-663s1c1
Sequence:CCGGCGACGTGCGCTTCGCGGAGTTCTCGAGAACTCCGCGAAGCGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152889.1-1056s21c1
Sequence:CCGGGCAAGTGCCTTTCCGACAAGACTCGAGTCTTGTCGGAAAGGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152889.1-1297s21c1
Sequence:CCGGGATGGGCAAGGACTTGATAACCTCGAGGTTATCAAGTCCTTGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152889.1-164s21c1
Sequence:CCGGTCTATGACCTGGATCAGGACCCTCGAGGGTCCTGATCCAGGTCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152889
CHST13 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 4) sulfotransferase 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-951s1c1
Sequence:CCGGGCGCCTCTTCGACCTCTACAACTCGAGTTGTAGAGGTCGAAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-537s1c1
Sequence:CCGGCCTGGCATCGGCTTACCGCAACTCGAGTTGCGGTAAGCCGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-960s1c1
Sequence:CCGGCGACCTCTACAAGATGGACTTCTCGAGAAGTCCATCTTGTAGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152889.1-663s1c1
Sequence:CCGGCGACGTGCGCTTCGCGGAGTTCTCGAGAACTCCGCGAAGCGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152889.1-1056s21c1
Sequence:CCGGGCAAGTGCCTTTCCGACAAGACTCGAGTCTTGTCGGAAAGGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152889.1-1297s21c1
Sequence:CCGGGATGGGCAAGGACTTGATAACCTCGAGGTTATCAAGTCCTTGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152889.1-164s21c1
Sequence:CCGGTCTATGACCTGGATCAGGACCCTCGAGGGTCCTGATCCAGGTCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027928
VALIDATED
CHST13 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 4) sulfotransferase 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-1108s21c1
Sequence:CCGGGTGTGGATTGGAGACCTTATCCTCGAGGATAAGGTCTCCAATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-958s21c1
Sequence:CCGGGTCGCCTCTTTAACCTCTATACTCGAGTATAGAGGTTAAAGAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-790s21c1
Sequence:CCGGATGATGTAGTGGGCAAGTTTGCTCGAGCAAACTTGCCCACTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-982s21c1
Sequence:CCGGTGGACTTTCTGCTCTTCAATTCTCGAGAATTGAAGAGCAGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027928.1-1015s21c1
Sequence:CCGGCCTACCTGCGACTGCAATAAGCTCGAGCTTATTGCAGTCGCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027928
VALIDATED
CHST13 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 4) sulfotransferase 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-1108s21c1
Sequence:CCGGGTGTGGATTGGAGACCTTATCCTCGAGGATAAGGTCTCCAATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-958s21c1
Sequence:CCGGGTCGCCTCTTTAACCTCTATACTCGAGTATAGAGGTTAAAGAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-790s21c1
Sequence:CCGGATGATGTAGTGGGCAAGTTTGCTCGAGCAAACTTGCCCACTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-982s21c1
Sequence:CCGGTGGACTTTCTGCTCTTCAATTCTCGAGAATTGAAGAGCAGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027928.1-1015s21c1
Sequence:CCGGCCTACCTGCGACTGCAATAAGCTCGAGCTTATTGCAGTCGCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027928
VALIDATED
CHST13 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 4) sulfotransferase 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-1108s21c1
Sequence:CCGGGTGTGGATTGGAGACCTTATCCTCGAGGATAAGGTCTCCAATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-958s21c1
Sequence:CCGGGTCGCCTCTTTAACCTCTATACTCGAGTATAGAGGTTAAAGAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-790s21c1
Sequence:CCGGATGATGTAGTGGGCAAGTTTGCTCGAGCAAACTTGCCCACTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027928.1-982s21c1
Sequence:CCGGTGGACTTTCTGCTCTTCAATTCTCGAGAATTGAAGAGCAGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027928.1-1015s21c1
Sequence:CCGGCCTACCTGCGACTGCAATAAGCTCGAGCTTATTGCAGTCGCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks