EMAIL THIS PAGE TO A FRIEND

CHST14

carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14

120 Gene Product Result for
Synonyms: ATCS D4ST1 HNK1ST
UniProtKB ID: Q8NCH0, Q6PJ31, Q6UXA0, Q96P94
Gene ID:
Human(113189) Summary: This gene encodes a member of the HNK-1 family of sulfotransferases. The encoded protein transfers sulfate to the C-4 hydroxyl of N-acetylgalactosamine residues in dermatan sulfate. Mutations in this gene have been associated with adducted thumb-clubfoot syndrome.[provided by RefSeq, Mar 2010]
Mouse(72136) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Rat(691394) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
naked mole-rat(101712567) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
domestic guinea pig(100715537) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
sheep(101108574) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Zebrafish(404732) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
chicken(770193) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
cow(511245) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
domestic cat(101089445) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
dog(608435) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130468 Rosetta Predictions human pricing
NM_001109639 Rosetta Predictions rat pricing
NM_028117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091997 predicted 1062
2 SASI_Hs01_00091998 predicted 1583
3 SASI_Hs01_00091999 predicted 906
4 SASI_Hs01_00092001 predicted 1768
5 SASI_Hs01_00092002 predicted 1771
6 SASI_Hs01_00092003 predicted 1050
7 SASI_Hs01_00092004 predicted 1763
8 SASI_Hs01_00092005 predicted 1053
9 SASI_Hs01_00092006 predicted 1555
10 SASI_Hs02_00362765 predicted 889
11 SASI_Hs01_00092000 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250322 predicted 838
2 SASI_Rn02_00250323 predicted 1178
3 SASI_Rn02_00250324 predicted 1283
4 SASI_Rn02_00250325 predicted 1293
5 SASI_Rn02_00250326 predicted 977
6 SASI_Rn02_00250327 predicted 1168
7 SASI_Rn02_00250328 predicted 940
8 SASI_Rn02_00250329 predicted 819
9 SASI_Rn02_00250330 predicted 665
10 SASI_Rn02_00250331 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075341 predicted 838
2 SASI_Mm01_00075342 predicted 1124
3 SASI_Mm01_00075343 predicted 1129
4 SASI_Mm01_00075344 predicted 1166
5 SASI_Mm01_00075345 predicted 838
6 SASI_Mm01_00075346 predicted 1275
7 SASI_Mm01_00075347 predicted 904
8 SASI_Mm02_00333373 predicted 1123
9 SASI_Mm01_00075348 predicted 375
10 SASI_Mm01_00075349 predicted 594
11 SASI_Mm01_00075350 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130468
CHST14 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130468.2-892s21c1
Sequence:CCGGGAGAGTACCAGCAACGCTATGCTCGAGCATAGCGTTGCTGGTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130468.2-1066s21c1
Sequence:CCGGGTGCCGTGCACTATGACTTTGCTCGAGCAAAGTCATAGTGCACGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130468.2-1773s21c1
Sequence:CCGGGTGAGCAATCATACCTTATAACTCGAGTTATAAGGTATGATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-1019s1c1
Sequence:CCGGGCGCATGAATGAGCATTGGATCTCGAGATCCAATGCTCATTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-1256s1c1
Sequence:CCGGGCCTAAGTATATCCTGGACTTCTCGAGAAGTCCAGGATATACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-812s1c1
Sequence:CCGGGCACTACTTTAAGTTCCTGTTCTCGAGAACAGGAACTTAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-869s1c1
Sequence:CCGGCCGCAACAAGTTTGGCGAGATCTCGAGATCTCGCCAAACTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-329s1c1
Sequence:CCGGCATGCTGATGTTTGCGGTGATCTCGAGATCACCGCAAACATCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130468
CHST14 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130468.2-892s21c1
Sequence:CCGGGAGAGTACCAGCAACGCTATGCTCGAGCATAGCGTTGCTGGTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130468.2-1066s21c1
Sequence:CCGGGTGCCGTGCACTATGACTTTGCTCGAGCAAAGTCATAGTGCACGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130468.2-1773s21c1
Sequence:CCGGGTGAGCAATCATACCTTATAACTCGAGTTATAAGGTATGATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-1019s1c1
Sequence:CCGGGCGCATGAATGAGCATTGGATCTCGAGATCCAATGCTCATTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-1256s1c1
Sequence:CCGGGCCTAAGTATATCCTGGACTTCTCGAGAAGTCCAGGATATACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-812s1c1
Sequence:CCGGGCACTACTTTAAGTTCCTGTTCTCGAGAACAGGAACTTAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-869s1c1
Sequence:CCGGCCGCAACAAGTTTGGCGAGATCTCGAGATCTCGCCAAACTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-329s1c1
Sequence:CCGGCATGCTGATGTTTGCGGTGATCTCGAGATCACCGCAAACATCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130468
CHST14 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130468.2-892s21c1
Sequence:CCGGGAGAGTACCAGCAACGCTATGCTCGAGCATAGCGTTGCTGGTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130468.2-1066s21c1
Sequence:CCGGGTGCCGTGCACTATGACTTTGCTCGAGCAAAGTCATAGTGCACGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130468.2-1773s21c1
Sequence:CCGGGTGAGCAATCATACCTTATAACTCGAGTTATAAGGTATGATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-1019s1c1
Sequence:CCGGGCGCATGAATGAGCATTGGATCTCGAGATCCAATGCTCATTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-1256s1c1
Sequence:CCGGGCCTAAGTATATCCTGGACTTCTCGAGAAGTCCAGGATATACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-812s1c1
Sequence:CCGGGCACTACTTTAAGTTCCTGTTCTCGAGAACAGGAACTTAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-869s1c1
Sequence:CCGGCCGCAACAAGTTTGGCGAGATCTCGAGATCTCGCCAAACTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130468.2-329s1c1
Sequence:CCGGCATGCTGATGTTTGCGGTGATCTCGAGATCACCGCAAACATCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028117
VALIDATED
CHST14 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1175s21c1
Sequence:CCGGAGATGTGCTACCTAAGTATATCTCGAGATATACTTAGGTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.2-258s21c1
Sequence:CCGGATGCTGATGTTCGCTGTAATCCTCGAGGATTACAGCGAACATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.2-819s21c1
Sequence:CCGGCGAGAGTACCAGCAGCGATATCTCGAGATATCGCTGCTGGTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1134s21c1
Sequence:CCGGCTGCATTACCACTTGTGCAATCTCGAGATTGCACAAGTGGTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.3-706s21c1
Sequence:CCGGACCGCAGTGACTTGGTGTTTCCTCGAGGAAACACCAAGTCACTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.3-1203s21c1
Sequence:CCGGGATGTGCTACCTAAGTATATCCTCGAGGATATACTTAGGTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1496s21c1
Sequence:CCGGGCAGGGCACCAGTGGTTATTACTCGAGTAATAACCACTGGTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-1504s1c1
Sequence:CCGGCCAGTGGTTATTAAAGCCATACTCGAGTATGGCTTTAATAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-1134s1c1
Sequence:CCGGCTGCATTACCACTTGTGCAATCTCGAGATTGCACAAGTGGTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028117.2-257s1c1
Sequence:CCGGCATGCTGATGTTCGCTGTAATCTCGAGATTACAGCGAACATCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-785s1c1
Sequence:CCGGCCTGTCTGCTTACCGTAACAACTCGAGTTGTTACGGTAAGCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028117.2-256s1c1
Sequence:CCGGCCATGCTGATGTTCGCTGTAACTCGAGTTACAGCGAACATCAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028117
VALIDATED
CHST14 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1175s21c1
Sequence:CCGGAGATGTGCTACCTAAGTATATCTCGAGATATACTTAGGTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.2-258s21c1
Sequence:CCGGATGCTGATGTTCGCTGTAATCCTCGAGGATTACAGCGAACATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.2-819s21c1
Sequence:CCGGCGAGAGTACCAGCAGCGATATCTCGAGATATCGCTGCTGGTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1134s21c1
Sequence:CCGGCTGCATTACCACTTGTGCAATCTCGAGATTGCACAAGTGGTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.3-706s21c1
Sequence:CCGGACCGCAGTGACTTGGTGTTTCCTCGAGGAAACACCAAGTCACTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.3-1203s21c1
Sequence:CCGGGATGTGCTACCTAAGTATATCCTCGAGGATATACTTAGGTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1496s21c1
Sequence:CCGGGCAGGGCACCAGTGGTTATTACTCGAGTAATAACCACTGGTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-1504s1c1
Sequence:CCGGCCAGTGGTTATTAAAGCCATACTCGAGTATGGCTTTAATAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-1134s1c1
Sequence:CCGGCTGCATTACCACTTGTGCAATCTCGAGATTGCACAAGTGGTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028117.2-257s1c1
Sequence:CCGGCATGCTGATGTTCGCTGTAATCTCGAGATTACAGCGAACATCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-785s1c1
Sequence:CCGGCCTGTCTGCTTACCGTAACAACTCGAGTTGTTACGGTAAGCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028117.2-256s1c1
Sequence:CCGGCCATGCTGATGTTCGCTGTAACTCGAGTTACAGCGAACATCAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028117
VALIDATED
CHST14 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1175s21c1
Sequence:CCGGAGATGTGCTACCTAAGTATATCTCGAGATATACTTAGGTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.2-258s21c1
Sequence:CCGGATGCTGATGTTCGCTGTAATCCTCGAGGATTACAGCGAACATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.2-819s21c1
Sequence:CCGGCGAGAGTACCAGCAGCGATATCTCGAGATATCGCTGCTGGTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1134s21c1
Sequence:CCGGCTGCATTACCACTTGTGCAATCTCGAGATTGCACAAGTGGTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028117.3-706s21c1
Sequence:CCGGACCGCAGTGACTTGGTGTTTCCTCGAGGAAACACCAAGTCACTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.3-1203s21c1
Sequence:CCGGGATGTGCTACCTAAGTATATCCTCGAGGATATACTTAGGTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028117.2-1496s21c1
Sequence:CCGGGCAGGGCACCAGTGGTTATTACTCGAGTAATAACCACTGGTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-1504s1c1
Sequence:CCGGCCAGTGGTTATTAAAGCCATACTCGAGTATGGCTTTAATAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-1134s1c1
Sequence:CCGGCTGCATTACCACTTGTGCAATCTCGAGATTGCACAAGTGGTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028117.2-257s1c1
Sequence:CCGGCATGCTGATGTTCGCTGTAATCTCGAGATTACAGCGAACATCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028117.2-785s1c1
Sequence:CCGGCCTGTCTGCTTACCGTAACAACTCGAGTTGTTACGGTAAGCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028117.2-256s1c1
Sequence:CCGGCCATGCTGATGTTCGCTGTAACTCGAGTTACAGCGAACATCAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks