EMAIL THIS PAGE TO A FRIEND

CHST15

carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15

109 Gene Product Result for
Synonyms: BRAG GALNAC4S-6ST RP11-47G11.1
UniProtKB ID: Q7LFX5, O60338, O60474, Q86VM4
Gene ID:
Human(51363) Summary: Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
Mouse(77590) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Rat(286974) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
chicken(423952) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
cow(534506) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Horse(100057594) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
domestic cat(101098166) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
dog(486928) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
sheep(101113976) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Domestic Rabbit(100343176) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
domestic guinea pig(100713991) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
naked mole-rat(101726691) carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015892 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024131 MISSION® esiRNA esiRNA targeting mouse 4631426J05Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015892 Rosetta Predictions human pricing
NM_173310 Rosetta Predictions rat pricing
NM_029935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012151 predicted 954
2 SASI_Hs01_00012152 predicted 2014
3 SASI_Hs01_00012154 predicted 1709
4 SASI_Hs01_00012155 predicted 2116
5 SASI_Hs01_00012156 predicted 950
6 SASI_Hs01_00012157 predicted 1722
7 SASI_Hs01_00012158 predicted 1624
8 SASI_Hs01_00012159 predicted 1719
9 SASI_Hs01_00012160 predicted 534
10 SASI_Hs02_00348481 predicted 1341
11 SASI_Hs01_00012153 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039093 predicted 526
2 SASI_Rn01_00039094 predicted 310
3 SASI_Rn02_00269402 predicted 395
4 SASI_Rn01_00039098 predicted 1209
5 SASI_Rn02_00269403 predicted 449
6 SASI_Rn02_00269404 predicted 423
7 SASI_Rn02_00269405 predicted 450
8 SASI_Rn01_00039101 predicted 1377
9 SASI_Rn02_00269406 predicted 544
10 SASI_Rn02_00269407 predicted 1217
11 SASI_Rn01_00039092 predicted 1221
12 SASI_Rn01_00039095 predicted 1740
13 SASI_Rn01_00039096 predicted 654
14 SASI_Rn01_00039097 predicted 454
15 SASI_Rn01_00039099 predicted 1631
16 SASI_Rn01_00039100 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154807 predicted 1071
2 SASI_Mm01_00154808 predicted 1091
3 SASI_Mm01_00154809 predicted 2282
4 SASI_Mm01_00154810 predicted 1196
5 SASI_Mm01_00154811 predicted 1163
6 SASI_Mm01_00154813 predicted 993
7 SASI_Mm01_00154814 predicted 1564
8 SASI_Mm01_00154815 predicted 853
9 SASI_Mm01_00154816 predicted 1755
10 SASI_Mm02_00336219 predicted 2155
11 SASI_Mm01_00154812 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029935
VALIDATED
CHST15 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029935.2-3263s1c1
Sequence:CCGGCCCTTAGAATGTCCTCAGAAACTCGAGTTTCTGAGGACATTCTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029935.2-803s1c1
Sequence:CCGGCCTGGTCTTTGGATTGATAATCTCGAGATTATCAATCCAAAGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029935.5-2002s21c1
Sequence:CCGGACGCATCCAATGTCAAGTATACTCGAGTATACTTGACATTGGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029935.5-4081s21c1
Sequence:CCGGGCGCGAACACTCGTGCTTATACTCGAGTATAAGCACGAGTGTTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-1770s21c1
Sequence:CCGGTACTTCGCAAGTTCCAATAAACTCGAGTTTATTGGAACTTGCGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029935.5-1769s1c1
Sequence:CCGGCTACTTCGCAAGTTCCAATAACTCGAGTTATTGGAACTTGCGAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-802s21c1
Sequence:CCGGGCCTGGTCTTTGGATTGATAACTCGAGTTATCAATCCAAAGACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-1008s21c1
Sequence:CCGGCCGAGCATTAAACTGATTATCCTCGAGGATAATCAGTTTAATGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029935
VALIDATED
CHST15 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029935.2-3263s1c1
Sequence:CCGGCCCTTAGAATGTCCTCAGAAACTCGAGTTTCTGAGGACATTCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029935.2-803s1c1
Sequence:CCGGCCTGGTCTTTGGATTGATAATCTCGAGATTATCAATCCAAAGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029935.5-2002s21c1
Sequence:CCGGACGCATCCAATGTCAAGTATACTCGAGTATACTTGACATTGGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029935.5-4081s21c1
Sequence:CCGGGCGCGAACACTCGTGCTTATACTCGAGTATAAGCACGAGTGTTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-1770s21c1
Sequence:CCGGTACTTCGCAAGTTCCAATAAACTCGAGTTTATTGGAACTTGCGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029935.5-1769s1c1
Sequence:CCGGCTACTTCGCAAGTTCCAATAACTCGAGTTATTGGAACTTGCGAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-802s21c1
Sequence:CCGGGCCTGGTCTTTGGATTGATAACTCGAGTTATCAATCCAAAGACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-1008s21c1
Sequence:CCGGCCGAGCATTAAACTGATTATCCTCGAGGATAATCAGTTTAATGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029935
VALIDATED
CHST15 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029935.2-3263s1c1
Sequence:CCGGCCCTTAGAATGTCCTCAGAAACTCGAGTTTCTGAGGACATTCTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029935.2-803s1c1
Sequence:CCGGCCTGGTCTTTGGATTGATAATCTCGAGATTATCAATCCAAAGACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029935.5-2002s21c1
Sequence:CCGGACGCATCCAATGTCAAGTATACTCGAGTATACTTGACATTGGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029935.5-4081s21c1
Sequence:CCGGGCGCGAACACTCGTGCTTATACTCGAGTATAAGCACGAGTGTTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-1770s21c1
Sequence:CCGGTACTTCGCAAGTTCCAATAAACTCGAGTTTATTGGAACTTGCGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029935.5-1769s1c1
Sequence:CCGGCTACTTCGCAAGTTCCAATAACTCGAGTTATTGGAACTTGCGAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-802s21c1
Sequence:CCGGGCCTGGTCTTTGGATTGATAACTCGAGTTATCAATCCAAAGACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029935.5-1008s21c1
Sequence:CCGGCCGAGCATTAAACTGATTATCCTCGAGGATAATCAGTTTAATGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015892
VALIDATED
CHST15 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-981s1c1
Sequence:CCGGCAACAGCATCACAACTAGGATCTCGAGATCCTAGTTGTGATGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-4470s1c1
Sequence:CCGGCCAAAGCAAATTGGAGCATTTCTCGAGAAATGCTCCAATTTGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-1699s1c1
Sequence:CCGGGAGAGGTTGTACTCAGACTATCTCGAGATAGTCTGAGTACAACCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015892.2-1965s1c1
Sequence:CCGGCGTCAAGTACACCATGCACAACTCGAGTTGTGCATGGTGTACTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015892.2-663s1c1
Sequence:CCGGGCAGATGAACTTGCTTGCTGTCTCGAGACAGCAAGCAAGTTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015892.2-4470s21c1
Sequence:CCGGCCAAAGCAAATTGGAGCATTTCTCGAGAAATGCTCCAATTTGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-1965s21c1
Sequence:CCGGCGTCAAGTACACCATGCACAACTCGAGTTGTGCATGGTGTACTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-1699s21c1
Sequence:CCGGGAGAGGTTGTACTCAGACTATCTCGAGATAGTCTGAGTACAACCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-981s21c1
Sequence:CCGGCAACAGCATCACAACTAGGATCTCGAGATCCTAGTTGTGATGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015892
VALIDATED
CHST15 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-981s1c1
Sequence:CCGGCAACAGCATCACAACTAGGATCTCGAGATCCTAGTTGTGATGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-4470s1c1
Sequence:CCGGCCAAAGCAAATTGGAGCATTTCTCGAGAAATGCTCCAATTTGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-1699s1c1
Sequence:CCGGGAGAGGTTGTACTCAGACTATCTCGAGATAGTCTGAGTACAACCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015892.2-1965s1c1
Sequence:CCGGCGTCAAGTACACCATGCACAACTCGAGTTGTGCATGGTGTACTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015892.2-663s1c1
Sequence:CCGGGCAGATGAACTTGCTTGCTGTCTCGAGACAGCAAGCAAGTTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015892.2-4470s21c1
Sequence:CCGGCCAAAGCAAATTGGAGCATTTCTCGAGAAATGCTCCAATTTGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-1965s21c1
Sequence:CCGGCGTCAAGTACACCATGCACAACTCGAGTTGTGCATGGTGTACTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-1699s21c1
Sequence:CCGGGAGAGGTTGTACTCAGACTATCTCGAGATAGTCTGAGTACAACCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-981s21c1
Sequence:CCGGCAACAGCATCACAACTAGGATCTCGAGATCCTAGTTGTGATGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015892
VALIDATED
CHST15 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-981s1c1
Sequence:CCGGCAACAGCATCACAACTAGGATCTCGAGATCCTAGTTGTGATGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-4470s1c1
Sequence:CCGGCCAAAGCAAATTGGAGCATTTCTCGAGAAATGCTCCAATTTGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015892.2-1699s1c1
Sequence:CCGGGAGAGGTTGTACTCAGACTATCTCGAGATAGTCTGAGTACAACCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015892.2-1965s1c1
Sequence:CCGGCGTCAAGTACACCATGCACAACTCGAGTTGTGCATGGTGTACTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015892.2-663s1c1
Sequence:CCGGGCAGATGAACTTGCTTGCTGTCTCGAGACAGCAAGCAAGTTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015892.2-4470s21c1
Sequence:CCGGCCAAAGCAAATTGGAGCATTTCTCGAGAAATGCTCCAATTTGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-1965s21c1
Sequence:CCGGCGTCAAGTACACCATGCACAACTCGAGTTGTGCATGGTGTACTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-1699s21c1
Sequence:CCGGGAGAGGTTGTACTCAGACTATCTCGAGATAGTCTGAGTACAACCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015892.2-981s21c1
Sequence:CCGGCAACAGCATCACAACTAGGATCTCGAGATCCTAGTTGTGATGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)