EMAIL THIS PAGE TO A FRIEND

CHST1

carbohydrate (keratan sulfate Gal-6) sulfotransferase 1

138 Gene Product Result for
Synonyms: C6ST GST-1 KS6ST KSGal6ST KSST
UniProtKB ID: O43916, D3DQP2
Gene ID:
Human(8534) Summary: This locus encodes a member of the keratin sulfotransferase family of proteins. The encoded enzyme catalyzes the sulfation of the proteoglycan keratin. [provided by RefSeq, Aug 2011]
Mouse(76969) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Rat(295934) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Zebrafish(445124) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
dog(483642) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
cow(506932) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
domestic cat(101085495) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
chicken(428866) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
domestic guinea pig(100722965) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
naked mole-rat(101709273) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
sheep(101112159) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Domestic Rabbit(100348291) carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV45495 Anti-CHST1 antibody produced in rabbit IgG fraction of antiserum bovine, canine, rabbit, mouse, rat, human, guinea pig
immunohistochemistry, western blot pricing
SAB2105639 Anti-CHST1 antibody produced in rabbit affinity isolated antibody rat, human, guinea pig, rabbit, mouse
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1367 Human CHST1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051001 MISSION® esiRNA esiRNA targeting mouse Chst1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003654 Rosetta Predictions human pricing
NM_001011955 Rosetta Predictions rat pricing
XM_575178 Rosetta Predictions rat pricing
NM_023850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150438 predicted 1376
2 SASI_Hs01_00150439 predicted 831
3 SASI_Hs01_00150440 predicted 1325
4 SASI_Hs01_00150442 predicted 1321
5 SASI_Hs01_00150443 predicted 1215
6 SASI_Hs01_00150444 predicted 1210
7 SASI_Hs02_00336029 predicted 1755
8 SASI_Hs01_00150446 predicted 1095
9 SASI_Hs01_00150447 predicted 1046
10 SASI_Hs02_00336030 predicted 1775
11 SASI_Hs01_00150441 predicted 1347
12 SASI_Hs01_00150445 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059755 predicted 571
2 SASI_Rn01_00059756 predicted 671
3 SASI_Rn01_00059757 predicted 454
4 SASI_Rn01_00059758 predicted 1002
5 SASI_Rn01_00059759 predicted 472
6 SASI_Rn01_00059760 predicted 1386
7 SASI_Rn01_00059761 predicted 1180
8 SASI_Rn01_00059762 predicted 368
9 SASI_Rn01_00059763 predicted 839
10 SASI_Rn02_00199971 predicted 456
11 SASI_Rn01_00059764 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156138 predicted 1933
2 SASI_Rn01_00156139 predicted 337
3 SASI_Rn01_00156140 predicted 1956
4 SASI_Rn01_00156141 predicted 401
5 SASI_Rn01_00156142 predicted 457
6 SASI_Rn01_00156143 predicted 1981
7 SASI_Rn01_00156144 predicted 472
8 SASI_Rn01_00156145 predicted 372
9 SASI_Rn01_00156146 predicted 382
10 SASI_Rn01_00156147 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051271 predicted 471
2 SASI_Mm01_00051272 predicted 210
3 SASI_Mm01_00051273 predicted 1195
4 SASI_Mm01_00051274 predicted 1385
5 SASI_Mm02_00327401 predicted 1388
6 SASI_Mm01_00051276 predicted 1031
7 SASI_Mm01_00051277 predicted 1763
8 SASI_Mm02_00327402 predicted 203
9 SASI_Mm02_00327403 predicted 1030
10 SASI_Mm01_00051278 predicted 739
11 SASI_Mm01_00051269 predicted 1120
12 SASI_Mm01_00051270 predicted 1401
13 SASI_Mm01_00051275 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003654
CHST1 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003654.4-1706s21c1
Sequence:CCGGCAAATACGGCACCGTGCGAAACTCGAGTTTCGCACGGTGCCGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003654.4-1969s21c1
Sequence:CCGGTTTAACTGTTGCCTTATTAACCTCGAGGTTAATAAGGCAACAGTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1556s1c1
Sequence:CCGGCAAGTACATGTTGGTGCGCTACTCGAGTAGCGCACCAACATGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1334s1c1
Sequence:CCGGAGACCCGCGATTAAACCTCAACTCGAGTTGAGGTTTAATCGCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1049s1c1
Sequence:CCGGCCTCTACGACTGCGACCTCTACTCGAGTAGAGGTCGCAGTCGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-953s1c1
Sequence:CCGGCCACGTCCAGAACACGCTCATCTCGAGATGAGCGTGTTCTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003654
CHST1 MISSION shRNA shRNA Plasmid DNA
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003654.4-1706s21c1
Sequence:CCGGCAAATACGGCACCGTGCGAAACTCGAGTTTCGCACGGTGCCGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003654.4-1969s21c1
Sequence:CCGGTTTAACTGTTGCCTTATTAACCTCGAGGTTAATAAGGCAACAGTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1556s1c1
Sequence:CCGGCAAGTACATGTTGGTGCGCTACTCGAGTAGCGCACCAACATGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1334s1c1
Sequence:CCGGAGACCCGCGATTAAACCTCAACTCGAGTTGAGGTTTAATCGCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1049s1c1
Sequence:CCGGCCTCTACGACTGCGACCTCTACTCGAGTAGAGGTCGCAGTCGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-953s1c1
Sequence:CCGGCCACGTCCAGAACACGCTCATCTCGAGATGAGCGTGTTCTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003654
CHST1 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003654.4-1706s21c1
Sequence:CCGGCAAATACGGCACCGTGCGAAACTCGAGTTTCGCACGGTGCCGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003654.4-1969s21c1
Sequence:CCGGTTTAACTGTTGCCTTATTAACCTCGAGGTTAATAAGGCAACAGTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1556s1c1
Sequence:CCGGCAAGTACATGTTGGTGCGCTACTCGAGTAGCGCACCAACATGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1334s1c1
Sequence:CCGGAGACCCGCGATTAAACCTCAACTCGAGTTGAGGTTTAATCGCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-1049s1c1
Sequence:CCGGCCTCTACGACTGCGACCTCTACTCGAGTAGAGGTCGCAGTCGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003654.2-953s1c1
Sequence:CCGGCCACGTCCAGAACACGCTCATCTCGAGATGAGCGTGTTCTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023850
CHST1 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-1014s1c1
Sequence:CCGGCCTGGCCAGAAATCCAATGAACTCGAGTTCATTGGATTTCTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-182s1c1
Sequence:CCGGCCGCCAAGTCTTTCCACACTTCTCGAGAAGTGTGGAAAGACTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-986s1c1
Sequence:CCGGGCAAGTACATGCTGGTACGTTCTCGAGAACGTACCAGCATGTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-475s1c1
Sequence:CCGGAGGAGCCTTTATGATTGTGATCTCGAGATCACAATCATAAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023850.1-1401s1c1
Sequence:CCGGGCCGTCTTTAACTGTTGCCTTCTCGAGAAGGCAACAGTTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023850
CHST1 MISSION shRNA shRNA Plasmid DNA
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-1014s1c1
Sequence:CCGGCCTGGCCAGAAATCCAATGAACTCGAGTTCATTGGATTTCTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-182s1c1
Sequence:CCGGCCGCCAAGTCTTTCCACACTTCTCGAGAAGTGTGGAAAGACTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-986s1c1
Sequence:CCGGGCAAGTACATGCTGGTACGTTCTCGAGAACGTACCAGCATGTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-475s1c1
Sequence:CCGGAGGAGCCTTTATGATTGTGATCTCGAGATCACAATCATAAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023850.1-1401s1c1
Sequence:CCGGGCCGTCTTTAACTGTTGCCTTCTCGAGAAGGCAACAGTTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023850
CHST1 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-1014s1c1
Sequence:CCGGCCTGGCCAGAAATCCAATGAACTCGAGTTCATTGGATTTCTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-182s1c1
Sequence:CCGGCCGCCAAGTCTTTCCACACTTCTCGAGAAGTGTGGAAAGACTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-986s1c1
Sequence:CCGGGCAAGTACATGCTGGTACGTTCTCGAGAACGTACCAGCATGTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023850.1-475s1c1
Sequence:CCGGAGGAGCCTTTATGATTGTGATCTCGAGATCACAATCATAAAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023850.1-1401s1c1
Sequence:CCGGGCCGTCTTTAACTGTTGCCTTCTCGAGAAGGCAACAGTTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks