EMAIL THIS PAGE TO A FRIEND

CHST2

carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2

88 Gene Product Result for
Synonyms: C6ST GST-2 GST2 Gn6ST-1 glcNAc6ST-1
UniProtKB ID: Q9Y4C5, D3DNG5, Q2M370, Q9GZN5, Q9UED5, Q9Y6F2
Gene ID:
Human(9435) Summary: This locus encodes a sulfotransferase protein. The encoded enzyme catalyzes the sulfation of a nonreducing N-acetylglucosamine residue, and may play a role in biosynthesis of 6-sulfosialyl Lewis X antigen. [provided by RefSeq, Aug 2011]
Mouse(54371) carbohydrate sulfotransferase 2
Rat(367145) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
naked mole-rat(101706657) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
domestic guinea pig(100714052) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
sheep(101105798) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Domestic Rabbit(100355215) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
chicken(429123) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
cow(615978) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
domestic cat(101096345) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
dog(485701) carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004267 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004267 Rosetta Predictions human pricing
XM_001068574 Rosetta Predictions rat pricing
XM_345970 Rosetta Predictions rat pricing
NM_018763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136436 predicted 2788
2 SASI_Hs01_00136437 predicted 2815
3 SASI_Hs01_00136438 predicted 2572
4 SASI_Hs01_00136439 predicted 2244
5 SASI_Hs01_00136440 predicted 2067
6 SASI_Hs01_00136441 predicted 1470
7 SASI_Hs01_00136442 predicted 2287
8 SASI_Hs02_00337231 predicted 2520
9 SASI_Hs01_00136443 predicted 2281
10 SASI_Hs01_00136445 predicted 2515
11 SASI_Hs01_00136444 predicted 2641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325020 predicted 2753
2 SASI_Rn02_00325021 predicted 2519
3 SASI_Rn02_00325022 predicted 2105
4 SASI_Rn02_00325023 predicted 2280
5 SASI_Rn02_00325024 predicted 2896
6 SASI_Rn02_00325025 predicted 2622
7 SASI_Rn02_00325026 predicted 1819
8 SASI_Rn02_00325027 predicted 3008
9 SASI_Rn02_00325028 predicted 1596
10 SASI_Rn02_00325029 predicted 2760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398922 predicted 1116
2 SASI_Rn02_00398923 predicted 978
3 SASI_Rn02_00398924 predicted 700
4 SASI_Rn02_00398925 predicted 884
5 SASI_Rn02_00398926 predicted 1088
6 SASI_Rn02_00398927 predicted 759
7 SASI_Rn02_00398928 predicted 587
8 SASI_Rn02_00398929 predicted 1147
9 SASI_Rn02_00398930 predicted 645
10 SASI_Rn02_00398931 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143813 predicted 2104
2 SASI_Mm01_00143814 predicted 2047
3 SASI_Mm01_00143816 predicted 1933
4 SASI_Mm01_00143817 predicted 2174
5 SASI_Mm01_00143818 predicted 2232
6 SASI_Mm02_00324071 predicted 1005
7 SASI_Mm01_00143819 predicted 1456
8 SASI_Mm01_00143821 predicted 1064
9 SASI_Mm01_00143822 predicted 1860
10 SASI_Mm02_00324072 predicted 2391
11 SASI_Mm01_00143815 predicted 892
12 SASI_Mm01_00143820 predicted 1112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018763
VALIDATED
CHST2 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1086s21c1
Sequence:CCGGGCTCAACCTCTTGGACTACAACTCGAGTTGTAGTCCAAGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018763.2-2518s21c1
Sequence:CCGGGATGGTGTTGTGTTTAAACAACTCGAGTTGTTTAAACACAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1095s21c1
Sequence:CCGGCTTGGACTACAAGTGGCATAACTCGAGTTATGCCACTTGTAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1849s21c1
Sequence:CCGGCTCAAGGTCATCCACCTAGTACTCGAGTACTAGGTGGATGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1970s1c1
Sequence:CCGGGATGGTGTTGTGTTTAAACAACTCGAGTTGTTTAAACACAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-538s1c1
Sequence:CCGGGCTCAACCTCTTGGACTACAACTCGAGTTGTAGTCCAAGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-547s1c1
Sequence:CCGGCTTGGACTACAAGTGGCATAACTCGAGTTATGCCACTTGTAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1879s1c1
Sequence:CCGGCAAAGACCTCAGCAAGACCTTCTCGAGAAGGTCTTGCTGAGGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1301s1c1
Sequence:CCGGCTCAAGGTCATCCACCTAGTACTCGAGTACTAGGTGGATGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018763
VALIDATED
CHST2 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1086s21c1
Sequence:CCGGGCTCAACCTCTTGGACTACAACTCGAGTTGTAGTCCAAGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018763.2-2518s21c1
Sequence:CCGGGATGGTGTTGTGTTTAAACAACTCGAGTTGTTTAAACACAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1095s21c1
Sequence:CCGGCTTGGACTACAAGTGGCATAACTCGAGTTATGCCACTTGTAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1849s21c1
Sequence:CCGGCTCAAGGTCATCCACCTAGTACTCGAGTACTAGGTGGATGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1970s1c1
Sequence:CCGGGATGGTGTTGTGTTTAAACAACTCGAGTTGTTTAAACACAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-538s1c1
Sequence:CCGGGCTCAACCTCTTGGACTACAACTCGAGTTGTAGTCCAAGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-547s1c1
Sequence:CCGGCTTGGACTACAAGTGGCATAACTCGAGTTATGCCACTTGTAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1879s1c1
Sequence:CCGGCAAAGACCTCAGCAAGACCTTCTCGAGAAGGTCTTGCTGAGGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1301s1c1
Sequence:CCGGCTCAAGGTCATCCACCTAGTACTCGAGTACTAGGTGGATGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018763
VALIDATED
CHST2 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1086s21c1
Sequence:CCGGGCTCAACCTCTTGGACTACAACTCGAGTTGTAGTCCAAGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018763.2-2518s21c1
Sequence:CCGGGATGGTGTTGTGTTTAAACAACTCGAGTTGTTTAAACACAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1095s21c1
Sequence:CCGGCTTGGACTACAAGTGGCATAACTCGAGTTATGCCACTTGTAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018763.2-1849s21c1
Sequence:CCGGCTCAAGGTCATCCACCTAGTACTCGAGTACTAGGTGGATGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1970s1c1
Sequence:CCGGGATGGTGTTGTGTTTAAACAACTCGAGTTGTTTAAACACAACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-538s1c1
Sequence:CCGGGCTCAACCTCTTGGACTACAACTCGAGTTGTAGTCCAAGAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-547s1c1
Sequence:CCGGCTTGGACTACAAGTGGCATAACTCGAGTTATGCCACTTGTAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1879s1c1
Sequence:CCGGCAAAGACCTCAGCAAGACCTTCTCGAGAAGGTCTTGCTGAGGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018763.1-1301s1c1
Sequence:CCGGCTCAAGGTCATCCACCTAGTACTCGAGTACTAGGTGGATGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004267
VALIDATED
CHST2 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1084s21c1
Sequence:CCGGGCTGGTGCTCACTATGCTCAACTCGAGTTGAGCATAGTGAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-2193s21c1
Sequence:CCGGCACTACGGAGAGTGTACGATTCTCGAGAATCGTACACTCTCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004267.3-2508s21c1
Sequence:CCGGCCTGTGGTGATACCTATAAAGCTCGAGCTTTATAGGTATCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1540s21c1
Sequence:CCGGGGACATGCTGAGCGCTCTTTACTCGAGTAAAGAGCGCTCAGCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1420s21c1
Sequence:CCGGGTCGTTCTTCGGCGAGCTATTCTCGAGAATAGCTCGCCGAAGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004267.2-930s1c1
Sequence:CCGGCTCTCTGTCTTCCAGTTGTATCTCGAGATACAACTGGAAGACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-1707s1c1
Sequence:CCGGCTCACCTTCCAGCAGATCAAACTCGAGTTTGATCTGCTGGAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004267.2-1428s1c1
Sequence:CCGGGCTATGGAGGTCATCTGCAATCTCGAGATTGCAGATGACCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-443s1c1
Sequence:CCGGGCTGGTGCTCACTATGCTCAACTCGAGTTGAGCATAGTGAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-1552s1c1
Sequence:CCGGCACTACGGAGAGTGTACGATTCTCGAGAATCGTACACTCTCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004267
VALIDATED
CHST2 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1084s21c1
Sequence:CCGGGCTGGTGCTCACTATGCTCAACTCGAGTTGAGCATAGTGAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-2193s21c1
Sequence:CCGGCACTACGGAGAGTGTACGATTCTCGAGAATCGTACACTCTCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004267.3-2508s21c1
Sequence:CCGGCCTGTGGTGATACCTATAAAGCTCGAGCTTTATAGGTATCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1540s21c1
Sequence:CCGGGGACATGCTGAGCGCTCTTTACTCGAGTAAAGAGCGCTCAGCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1420s21c1
Sequence:CCGGGTCGTTCTTCGGCGAGCTATTCTCGAGAATAGCTCGCCGAAGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004267.2-930s1c1
Sequence:CCGGCTCTCTGTCTTCCAGTTGTATCTCGAGATACAACTGGAAGACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-1707s1c1
Sequence:CCGGCTCACCTTCCAGCAGATCAAACTCGAGTTTGATCTGCTGGAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004267.2-1428s1c1
Sequence:CCGGGCTATGGAGGTCATCTGCAATCTCGAGATTGCAGATGACCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-443s1c1
Sequence:CCGGGCTGGTGCTCACTATGCTCAACTCGAGTTGAGCATAGTGAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-1552s1c1
Sequence:CCGGCACTACGGAGAGTGTACGATTCTCGAGAATCGTACACTCTCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004267
VALIDATED
CHST2 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1084s21c1
Sequence:CCGGGCTGGTGCTCACTATGCTCAACTCGAGTTGAGCATAGTGAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-2193s21c1
Sequence:CCGGCACTACGGAGAGTGTACGATTCTCGAGAATCGTACACTCTCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004267.3-2508s21c1
Sequence:CCGGCCTGTGGTGATACCTATAAAGCTCGAGCTTTATAGGTATCACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1540s21c1
Sequence:CCGGGGACATGCTGAGCGCTCTTTACTCGAGTAAAGAGCGCTCAGCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004267.3-1420s21c1
Sequence:CCGGGTCGTTCTTCGGCGAGCTATTCTCGAGAATAGCTCGCCGAAGAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004267.2-930s1c1
Sequence:CCGGCTCTCTGTCTTCCAGTTGTATCTCGAGATACAACTGGAAGACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-1707s1c1
Sequence:CCGGCTCACCTTCCAGCAGATCAAACTCGAGTTTGATCTGCTGGAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004267.2-1428s1c1
Sequence:CCGGGCTATGGAGGTCATCTGCAATCTCGAGATTGCAGATGACCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-443s1c1
Sequence:CCGGGCTGGTGCTCACTATGCTCAACTCGAGTTGAGCATAGTGAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004267.2-1552s1c1
Sequence:CCGGCACTACGGAGAGTGTACGATTCTCGAGAATCGTACACTCTCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks