EMAIL THIS PAGE TO A FRIEND

CHST3

carbohydrate (chondroitin 6) sulfotransferase 3

Synonyms: C6ST C6ST1 HSD
UniProtKB ID: Q7LGC8, O75099, Q52M30
Gene ID:
Human(9469) Summary: This gene encodes an enzyme which catalyzes the sulfation of chondroitin, a proteoglycan found in the extracellular matrix and most cells which is involved in cell migration and differentiation. Mutations in this gene are associated with spondylepiphyseal dysplasia and humerospinal dysostosis. [provided by RefSeq, Mar 2009]
Mouse(53374) carbohydrate (chondroitin 6/keratan) sulfotransferase 3
Rat(84468) carbohydrate (chondroitin 6) sulfotransferase 3
chicken(396018) carbohydrate (chondroitin 6) sulfotransferase 3
cow(506758) carbohydrate (chondroitin 6) sulfotransferase 3
Horse(100063554) carbohydrate (chondroitin 6) sulfotransferase 3
domestic cat(101080828) carbohydrate (chondroitin 6) sulfotransferase 3
dog(100855759) carbohydrate (chondroitin 6) sulfotransferase 3
dog(489036) carbohydrate (chondroitin 6) sulfotransferase 3
sheep(101112877) carbohydrate (chondroitin 6) sulfotransferase 3
domestic guinea pig(100713672) carbohydrate (chondroitin 6) sulfotransferase 3
naked mole-rat(101724635) carbohydrate (chondroitin 6) sulfotransferase 3
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004273 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004273 Rosetta Predictions human pricing
NM_053408 Rosetta Predictions rat pricing
NM_016803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155289 predicted 1526
2 SASI_Hs01_00155290 predicted 473
3 SASI_Hs01_00155292 predicted 643
4 SASI_Hs01_00155294 predicted 647
5 SASI_Hs01_00155295 predicted 605
6 SASI_Hs01_00155296 predicted 657
7 SASI_Hs01_00155298 predicted 865
8 SASI_Hs02_00337252 predicted 1242
9 SASI_Hs02_00337253 predicted 2134
10 SASI_Hs02_00337254 predicted 1628
11 SASI_Hs01_00155291 predicted 1842
12 SASI_Hs01_00155293 predicted 1725
13 SASI_Hs01_00155297 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265929 predicted 566
2 SASI_Rn01_00074965 predicted 432
3 SASI_Rn01_00074966 predicted 791
4 SASI_Rn01_00074967 predicted 1072
5 SASI_Rn01_00074968 predicted 588
6 SASI_Rn01_00074969 predicted 678
7 SASI_Rn02_00265930 predicted 246
8 SASI_Rn01_00074971 predicted 734
9 SASI_Rn01_00074972 predicted 573
10 SASI_Rn01_00074974 predicted 706
11 SASI_Rn01_00074970 predicted 631
12 SASI_Rn01_00074973 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077255 predicted 1421
2 SASI_Mm01_00077256 predicted 1990
3 SASI_Mm01_00077257 predicted 1701
4 SASI_Mm01_00077259 predicted 1565
5 SASI_Mm01_00077260 predicted 572
6 SASI_Mm01_00077261 predicted 545
7 SASI_Mm01_00077262 predicted 1040
8 SASI_Mm01_00077263 predicted 1194
9 SASI_Mm02_00323591 predicted 720
10 SASI_Mm01_00077264 predicted 527
11 SASI_Mm01_00077258 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016803
CHST3 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 6) sulfotransferase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016803.2-3268s1c1
Sequence:CCGGCCCAGCATTCAGGAAATCAAACTCGAGTTTGATTTCCTGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-545s1c1
Sequence:CCGGGCCTAAAGATTCGAGGCAGATCTCGAGATCTGCCTCGAATCTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1711s1c1
Sequence:CCGGGATGTCTACTCCACTCAGAAACTCGAGTTTCTGAGTGGAGTAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1347s1c1
Sequence:CCGGGAGGTTGGATCTACGAGTCATCTCGAGATGACTCGTAGATCCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1183s1c1
Sequence:CCGGCCCTTCGTCAAGAAGGTCTTTCTCGAGAAAGACCTTCTTGACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016803
CHST3 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 6) sulfotransferase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016803.2-3268s1c1
Sequence:CCGGCCCAGCATTCAGGAAATCAAACTCGAGTTTGATTTCCTGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-545s1c1
Sequence:CCGGGCCTAAAGATTCGAGGCAGATCTCGAGATCTGCCTCGAATCTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1711s1c1
Sequence:CCGGGATGTCTACTCCACTCAGAAACTCGAGTTTCTGAGTGGAGTAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1347s1c1
Sequence:CCGGGAGGTTGGATCTACGAGTCATCTCGAGATGACTCGTAGATCCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1183s1c1
Sequence:CCGGCCCTTCGTCAAGAAGGTCTTTCTCGAGAAAGACCTTCTTGACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016803
CHST3 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 6) sulfotransferase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016803.2-3268s1c1
Sequence:CCGGCCCAGCATTCAGGAAATCAAACTCGAGTTTGATTTCCTGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-545s1c1
Sequence:CCGGGCCTAAAGATTCGAGGCAGATCTCGAGATCTGCCTCGAATCTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1711s1c1
Sequence:CCGGGATGTCTACTCCACTCAGAAACTCGAGTTTCTGAGTGGAGTAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1347s1c1
Sequence:CCGGGAGGTTGGATCTACGAGTCATCTCGAGATGACTCGTAGATCCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016803.2-1183s1c1
Sequence:CCGGCCCTTCGTCAAGAAGGTCTTTCTCGAGAAAGACCTTCTTGACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004273
VALIDATED
CHST3 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (chondroitin 6) sulfotransferase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-499s1c1
Sequence:CCGGTGAGAAGCAAATACGCCCTTTCTCGAGAAAGGGCGTATTTGCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-1163s1c1
Sequence:CCGGCTTCGAGAAGTACCACTGCAACTCGAGTTGCAGTGGTACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004273.2-1709s1c1
Sequence:CCGGGCAGTTCGAGAAGTGGCGCTTCTCGAGAAGCGCCACTTCTCGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-646s1c1
Sequence:CCGGTGATCTTAGCTGAGAACGCATCTCGAGATGCGTTCTCAGCTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004273.2-1079s1c1
Sequence:CCGGCCACCTGACTCAGTTCATGTTCTCGAGAACATGAACTGAGTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004273.4-1782s21c1
Sequence:CCGGATGCGCCTCTTCGGCTACAAACTCGAGTTTGTAGCCGAAGAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-1079s21c1
Sequence:CCGGCCACCTGACTCAGTTCATGTTCTCGAGAACATGAACTGAGTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-1139s21c1
Sequence:CCGGCTGTACGCCCTTCGTCAAGAACTCGAGTTCTTGACGAAGGGCGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-586s21c1
Sequence:CCGGCAGACAAGCTGAAGCAGATTCCTCGAGGAATCTGCTTCAGCTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004273.4-2197s21c1
Sequence:CCGGTGCAGGCCAGAGTCCAAATATCTCGAGATATTTGGACTCTGGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004273
VALIDATED
CHST3 MISSION shRNA shRNA Plasmid DNA
carbohydrate (chondroitin 6) sulfotransferase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-499s1c1
Sequence:CCGGTGAGAAGCAAATACGCCCTTTCTCGAGAAAGGGCGTATTTGCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-1163s1c1
Sequence:CCGGCTTCGAGAAGTACCACTGCAACTCGAGTTGCAGTGGTACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004273.2-1709s1c1
Sequence:CCGGGCAGTTCGAGAAGTGGCGCTTCTCGAGAAGCGCCACTTCTCGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-646s1c1
Sequence:CCGGTGATCTTAGCTGAGAACGCATCTCGAGATGCGTTCTCAGCTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004273.2-1079s1c1
Sequence:CCGGCCACCTGACTCAGTTCATGTTCTCGAGAACATGAACTGAGTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004273.4-1782s21c1
Sequence:CCGGATGCGCCTCTTCGGCTACAAACTCGAGTTTGTAGCCGAAGAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-1079s21c1
Sequence:CCGGCCACCTGACTCAGTTCATGTTCTCGAGAACATGAACTGAGTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-1139s21c1
Sequence:CCGGCTGTACGCCCTTCGTCAAGAACTCGAGTTCTTGACGAAGGGCGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-586s21c1
Sequence:CCGGCAGACAAGCTGAAGCAGATTCCTCGAGGAATCTGCTTCAGCTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004273.4-2197s21c1
Sequence:CCGGTGCAGGCCAGAGTCCAAATATCTCGAGATATTTGGACTCTGGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004273
VALIDATED
CHST3 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (chondroitin 6) sulfotransferase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-499s1c1
Sequence:CCGGTGAGAAGCAAATACGCCCTTTCTCGAGAAAGGGCGTATTTGCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-1163s1c1
Sequence:CCGGCTTCGAGAAGTACCACTGCAACTCGAGTTGCAGTGGTACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004273.2-1709s1c1
Sequence:CCGGGCAGTTCGAGAAGTGGCGCTTCTCGAGAAGCGCCACTTCTCGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004273.2-646s1c1
Sequence:CCGGTGATCTTAGCTGAGAACGCATCTCGAGATGCGTTCTCAGCTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004273.2-1079s1c1
Sequence:CCGGCCACCTGACTCAGTTCATGTTCTCGAGAACATGAACTGAGTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004273.4-1782s21c1
Sequence:CCGGATGCGCCTCTTCGGCTACAAACTCGAGTTTGTAGCCGAAGAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-1079s21c1
Sequence:CCGGCCACCTGACTCAGTTCATGTTCTCGAGAACATGAACTGAGTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-1139s21c1
Sequence:CCGGCTGTACGCCCTTCGTCAAGAACTCGAGTTCTTGACGAAGGGCGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004273.4-586s21c1
Sequence:CCGGCAGACAAGCTGAAGCAGATTCCTCGAGGAATCTGCTTCAGCTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004273.4-2197s21c1
Sequence:CCGGTGCAGGCCAGAGTCCAAATATCTCGAGATATTTGGACTCTGGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks