EMAIL THIS PAGE TO A FRIEND

CHST4

carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4

92 Gene Product Result for
Synonyms: GST3 GlcNAc6ST2 HECGLCNAC6ST LSST
UniProtKB ID: Q8NCG5, Q8IV46, Q9Y5R3
Gene ID:
Human(10164) Summary: This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
Mouse(26887) carbohydrate (chondroitin 6/keratan) sulfotransferase 4
Rat(307838) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
chicken(427567) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
dog(489722) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
cow(539063) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
domestic cat(101080851) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
naked mole-rat(101698578) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
domestic guinea pig(100719794) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
sheep(101104927) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1368 Human CHST4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005769 Rosetta Predictions human pricing
NM_001107427 Rosetta Predictions rat pricing
NM_011998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104858 predicted 899
2 SASI_Hs01_00104859 predicted 234
3 SASI_Hs01_00104860 predicted 1284
4 SASI_Hs01_00104861 predicted 1233
5 SASI_Hs01_00104862 predicted 589
6 SASI_Hs01_00104863 predicted 1382
7 SASI_Hs01_00104864 predicted 1080
8 SASI_Hs01_00104865 predicted 1425
9 SASI_Hs01_00104866 predicted 834
10 SASI_Hs01_00104867 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228715 predicted 767
2 SASI_Rn02_00228716 predicted 1346
3 SASI_Rn02_00228717 predicted 990
4 SASI_Rn02_00228718 predicted 893
5 SASI_Rn02_00228719 predicted 748
6 SASI_Rn02_00228720 predicted 946
7 SASI_Rn02_00228721 predicted 1307
8 SASI_Rn02_00228722 predicted 816
9 SASI_Rn02_00228723 predicted 1100
10 SASI_Rn02_00228724 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183207 predicted 758
2 SASI_Mm02_00321930 predicted 1145
3 SASI_Mm01_00183209 predicted 1426
4 SASI_Mm02_00321931 predicted 994
5 SASI_Mm02_00321932 predicted 1368
6 SASI_Mm02_00321933 predicted 822
7 SASI_Mm02_00321934 predicted 752
8 SASI_Mm02_00321935 predicted 1311
9 SASI_Mm02_00321936 predicted 1307
10 SASI_Mm02_00321937 predicted 1541
11 SASI_Mm01_00183205 predicted 1214
12 SASI_Mm01_00183206 predicted 1858
13 SASI_Mm01_00183208 predicted 1872
14 SASI_Mm01_00183210 predicted 963
15 SASI_Mm01_00183211 predicted 1603
16 SASI_Mm01_00183212 predicted 1924
17 SASI_Mm01_00183213 predicted 1915
18 SASI_Mm01_00183214 predicted 1864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005769
CHST4 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005769.2-519s21c1
Sequence:CCGGTGTGCGACATGAGCGTCTTTGCTCGAGCAAAGACGCTCATGTCGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005769.2-1773s21c1
Sequence:CCGGTTTCCACAGAGATGCAAATTCCTCGAGGAATTTGCATCTCTGTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005769.2-861s21c1
Sequence:CCGGCAAAGGGAGATCTCATGATTGCTCGAGCAATCATGAGATCTCCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-229s1c1
Sequence:CCGGGATGGCCATCTTGGCTCTATTCTCGAGAATAGAGCCAAGATGGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1130s1c1
Sequence:CCGGGACCACGCTTTCCACACAAATCTCGAGATTTGTGTGGAAAGCGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-593s1c1
Sequence:CCGGTGTGACATCATCCCACAAGATCTCGAGATCTTGTGGGATGATGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1237s1c1
Sequence:CCGGTGCCATGAATTTGCTGGGCTACTCGAGTAGCCCAGCAAATTCATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1185s1c1
Sequence:CCGGGCTGGTCTTTGCCCTATGAAACTCGAGTTTCATAGGGCAAAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005769
CHST4 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005769.2-519s21c1
Sequence:CCGGTGTGCGACATGAGCGTCTTTGCTCGAGCAAAGACGCTCATGTCGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005769.2-1773s21c1
Sequence:CCGGTTTCCACAGAGATGCAAATTCCTCGAGGAATTTGCATCTCTGTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005769.2-861s21c1
Sequence:CCGGCAAAGGGAGATCTCATGATTGCTCGAGCAATCATGAGATCTCCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-229s1c1
Sequence:CCGGGATGGCCATCTTGGCTCTATTCTCGAGAATAGAGCCAAGATGGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1130s1c1
Sequence:CCGGGACCACGCTTTCCACACAAATCTCGAGATTTGTGTGGAAAGCGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-593s1c1
Sequence:CCGGTGTGACATCATCCCACAAGATCTCGAGATCTTGTGGGATGATGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1237s1c1
Sequence:CCGGTGCCATGAATTTGCTGGGCTACTCGAGTAGCCCAGCAAATTCATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1185s1c1
Sequence:CCGGGCTGGTCTTTGCCCTATGAAACTCGAGTTTCATAGGGCAAAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005769
CHST4 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005769.2-519s21c1
Sequence:CCGGTGTGCGACATGAGCGTCTTTGCTCGAGCAAAGACGCTCATGTCGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005769.2-1773s21c1
Sequence:CCGGTTTCCACAGAGATGCAAATTCCTCGAGGAATTTGCATCTCTGTGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005769.2-861s21c1
Sequence:CCGGCAAAGGGAGATCTCATGATTGCTCGAGCAATCATGAGATCTCCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-229s1c1
Sequence:CCGGGATGGCCATCTTGGCTCTATTCTCGAGAATAGAGCCAAGATGGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1130s1c1
Sequence:CCGGGACCACGCTTTCCACACAAATCTCGAGATTTGTGTGGAAAGCGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-593s1c1
Sequence:CCGGTGTGACATCATCCCACAAGATCTCGAGATCTTGTGGGATGATGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1237s1c1
Sequence:CCGGTGCCATGAATTTGCTGGGCTACTCGAGTAGCCCAGCAAATTCATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005769.1-1185s1c1
Sequence:CCGGGCTGGTCTTTGCCCTATGAAACTCGAGTTTCATAGGGCAAAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011998
CHST4 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011998.3-1511s1c1
Sequence:CCGGCCAGCCTTAGTCACCATTAAACTCGAGTTTAATGGTGACTAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-973s1c1
Sequence:CCGGGAACTCGTGGTTGACAGTCATCTCGAGATGACTGTCAACCACGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1218s1c1
Sequence:CCGGCCTCCAAACATGGGTTCACAACTCGAGTTGTGAACCCATGTTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1035s1c1
Sequence:CCGGCCAGCCCTATTATGCCATGAACTCGAGTTCATGGCATAATAGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1318s1c1
Sequence:CCGGCGTTGGTCCTTACCTTACGAACTCGAGTTCGTAAGGTAAGGACCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011998
CHST4 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011998.3-1511s1c1
Sequence:CCGGCCAGCCTTAGTCACCATTAAACTCGAGTTTAATGGTGACTAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-973s1c1
Sequence:CCGGGAACTCGTGGTTGACAGTCATCTCGAGATGACTGTCAACCACGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1218s1c1
Sequence:CCGGCCTCCAAACATGGGTTCACAACTCGAGTTGTGAACCCATGTTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1035s1c1
Sequence:CCGGCCAGCCCTATTATGCCATGAACTCGAGTTCATGGCATAATAGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1318s1c1
Sequence:CCGGCGTTGGTCCTTACCTTACGAACTCGAGTTCGTAAGGTAAGGACCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011998
CHST4 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011998.3-1511s1c1
Sequence:CCGGCCAGCCTTAGTCACCATTAAACTCGAGTTTAATGGTGACTAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-973s1c1
Sequence:CCGGGAACTCGTGGTTGACAGTCATCTCGAGATGACTGTCAACCACGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1218s1c1
Sequence:CCGGCCTCCAAACATGGGTTCACAACTCGAGTTGTGAACCCATGTTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1035s1c1
Sequence:CCGGCCAGCCCTATTATGCCATGAACTCGAGTTCATGGCATAATAGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011998.3-1318s1c1
Sequence:CCGGCGTTGGTCCTTACCTTACGAACTCGAGTTCGTAAGGTAAGGACCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)